Incidental Mutation 'R2871:Rnf6'
ID253718
Institutional Source Beutler Lab
Gene Symbol Rnf6
Ensembl Gene ENSMUSG00000029634
Gene Namering finger protein (C3H2C3 type) 6
Synonyms5730419H05Rik, 1200013I08Rik
MMRRC Submission 040459-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.766) question?
Stock #R2871 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location146209192-146221555 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 146210405 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 601 (Y601C)
Ref Sequence ENSEMBL: ENSMUSP00000128774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067837] [ENSMUST00000159074] [ENSMUST00000161331] [ENSMUST00000161574] [ENSMUST00000161859] [ENSMUST00000169407]
Predicted Effect probably benign
Transcript: ENSMUST00000067837
AA Change: Y601C

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000067559
Gene: ENSMUSG00000029634
AA Change: Y601C

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 79 95 N/A INTRINSIC
low complexity region 187 215 N/A INTRINSIC
low complexity region 513 530 N/A INTRINSIC
RING 614 654 6.68e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159074
SMART Domains Protein: ENSMUSP00000123926
Gene: ENSMUSG00000029634

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
low complexity region 90 106 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161331
SMART Domains Protein: ENSMUSP00000125611
Gene: ENSMUSG00000029634

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 79 95 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161574
SMART Domains Protein: ENSMUSP00000123730
Gene: ENSMUSG00000029634

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
low complexity region 90 106 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161859
AA Change: Y601C

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000124293
Gene: ENSMUSG00000029634
AA Change: Y601C

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 79 95 N/A INTRINSIC
low complexity region 187 215 N/A INTRINSIC
low complexity region 513 530 N/A INTRINSIC
RING 614 654 6.68e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162219
SMART Domains Protein: ENSMUSP00000123708
Gene: ENSMUSG00000029634

DomainStartEndE-ValueType
low complexity region 49 65 N/A INTRINSIC
low complexity region 157 185 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169407
AA Change: Y601C

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000128774
Gene: ENSMUSG00000029634
AA Change: Y601C

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 79 95 N/A INTRINSIC
low complexity region 187 215 N/A INTRINSIC
low complexity region 513 530 N/A INTRINSIC
RING 614 654 6.68e-6 SMART
Meta Mutation Damage Score 0.3478 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.2%
  • 10x: 92.4%
  • 20x: 72.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING-H2 finger motif. Deletions and mutations in this gene were detected in esophageal squamous cell carcinoma (ESCC), suggesting that this protein may be a potential tumor suppressor. Studies of the mouse counterpart suggested a role of this protein in the transcription regulation that controls germinal differentiation. Multiple alternatively spliced transcript variants encoding the same protein are observed. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,955,176 C811R possibly damaging Het
AI481877 A C 4: 59,093,850 L226R probably damaging Het
Akap8l G A 17: 32,338,442 T65I possibly damaging Het
Arid4a T A 12: 71,022,260 probably null Het
Armc2 C T 10: 41,966,700 probably null Het
Atp6v1g1 A G 4: 63,550,021 Y87C probably benign Het
Cfap54 A T 10: 92,921,419 F273I possibly damaging Het
Clasrp C A 7: 19,585,240 probably benign Het
Csmd2 T C 4: 128,557,718 F113S unknown Het
Cyp4a14 C A 4: 115,487,301 G456W probably damaging Het
Cyp4a30b A G 4: 115,458,362 H260R possibly damaging Het
Ddrgk1 T A 2: 130,664,644 probably benign Het
Dhx57 A T 17: 80,251,376 D1051E probably benign Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Eif4enif1 C T 11: 3,242,586 P805S probably damaging Het
Eml5 C T 12: 98,865,401 D433N probably damaging Het
Fan1 A G 7: 64,363,190 I668T probably benign Het
Frmpd4 A T X: 167,477,247 D1166E probably benign Het
Gm813 A T 16: 58,613,979 I125K probably benign Het
Gria2 G A 3: 80,702,492 T670I probably damaging Het
Grid2ip C A 5: 143,357,929 Q127K probably benign Het
Hdhd2 T C 18: 76,955,006 F44L probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hmcn1 A T 1: 150,738,716 V1313D possibly damaging Het
Ift172 C T 5: 31,257,861 V1335I probably benign Het
Ighv2-2 G A 12: 113,588,498 T40I possibly damaging Het
Kcnk10 T A 12: 98,434,813 R520S probably benign Het
Kif1c A G 11: 70,724,081 E567G probably damaging Het
Klf8 A T X: 153,382,682 E82D probably damaging Het
Kpna7 T C 5: 144,993,935 T367A probably benign Het
Lpo A G 11: 87,816,524 I221T possibly damaging Het
Lrrn3 T C 12: 41,452,723 I532V probably benign Het
Matr3 T A 18: 35,572,296 S91R probably benign Het
Mki67 G A 7: 135,708,149 P191L probably benign Het
Mlxip A G 5: 123,452,667 M878V probably benign Het
Mpp7 G A 18: 7,461,678 P65L possibly damaging Het
Mroh2a C A 1: 88,255,565 L1292I probably damaging Het
Msh2 C A 17: 87,685,584 Q314K possibly damaging Het
Mtor T A 4: 148,540,030 M2089K probably benign Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nlrp4b C T 7: 10,710,243 Q40* probably null Het
Nomo1 C A 7: 46,046,937 T293N probably damaging Het
Notum A G 11: 120,660,196 V48A probably benign Het
Npas3 C T 12: 54,068,013 R542* probably null Het
Olfr1101 A T 2: 86,988,848 C109* probably null Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Olfr45 A G 7: 140,691,285 I127V possibly damaging Het
Olfr71 C A 4: 43,706,458 V37L probably benign Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Pcdhga9 T A 18: 37,737,471 Y118N possibly damaging Het
Pes1 C A 11: 3,976,834 T372K probably benign Het
Pkp4 C A 2: 59,308,156 T250K probably benign Het
Plekhg5 T A 4: 152,107,503 C433S probably benign Het
Plin2 A G 4: 86,668,678 M1T probably null Het
Prdx4 A G X: 155,340,464 V15A probably benign Het
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Psmd13 A T 7: 140,887,055 T116S probably damaging Het
Rel T C 11: 23,761,129 I13V probably benign Het
Reln C T 5: 22,049,791 V527I possibly damaging Het
Rps6kc1 T C 1: 190,899,569 I48M probably damaging Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Slc39a8 T A 3: 135,886,793 probably null Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
St5 A T 7: 109,557,430 Y38N probably benign Het
Tnni3k C T 3: 154,938,750 probably null Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vmn2r70 T A 7: 85,559,019 Y750F probably damaging Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Other mutations in Rnf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Rnf6 APN 5 146211905 missense possibly damaging 0.86
IGL01432:Rnf6 APN 5 146216121 missense possibly damaging 0.61
IGL01722:Rnf6 APN 5 146210226 missense probably benign
IGL01866:Rnf6 APN 5 146210907 missense probably damaging 0.99
R0141:Rnf6 UTSW 5 146211835 missense possibly damaging 0.95
R0551:Rnf6 UTSW 5 146211395 missense possibly damaging 0.65
R0619:Rnf6 UTSW 5 146210721 missense possibly damaging 0.58
R0685:Rnf6 UTSW 5 146211658 missense probably damaging 0.99
R1363:Rnf6 UTSW 5 146211559 missense probably benign
R1387:Rnf6 UTSW 5 146211245 missense probably benign 0.00
R1671:Rnf6 UTSW 5 146211188 nonsense probably null
R2047:Rnf6 UTSW 5 146211864 missense probably damaging 0.99
R2074:Rnf6 UTSW 5 146210906 missense probably damaging 0.98
R2107:Rnf6 UTSW 5 146211281 missense probably damaging 0.99
R2871:Rnf6 UTSW 5 146210405 missense probably benign 0.07
R2873:Rnf6 UTSW 5 146210405 missense probably benign 0.07
R2874:Rnf6 UTSW 5 146210405 missense probably benign 0.07
R4361:Rnf6 UTSW 5 146211279 missense probably damaging 1.00
R5421:Rnf6 UTSW 5 146210529 missense probably benign 0.06
R5437:Rnf6 UTSW 5 146210280 missense probably damaging 1.00
R5614:Rnf6 UTSW 5 146218100 splice site probably null
R5848:Rnf6 UTSW 5 146211149 missense probably benign 0.25
R7515:Rnf6 UTSW 5 146211792 missense probably damaging 1.00
R7589:Rnf6 UTSW 5 146211429 missense possibly damaging 0.92
R7767:Rnf6 UTSW 5 146211176 missense probably damaging 0.98
R7767:Rnf6 UTSW 5 146211177 nonsense probably null
R8155:Rnf6 UTSW 5 146211005 missense probably damaging 0.96
R8205:Rnf6 UTSW 5 146210904 missense probably damaging 0.98
R8302:Rnf6 UTSW 5 146211524 missense probably benign
R8433:Rnf6 UTSW 5 146211278 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGCTCCGAATTCTAAGACAGG -3'
(R):5'- TGAAATGCTAGCTGTGAGGG -3'

Sequencing Primer
(F):5'- GAATTCTAAGACAGGCCGCCG -3'
(R):5'- TAGCTGTGAGGGAGCCC -3'
Posted On2014-12-04