Incidental Mutation 'R2871:Clasrp'
ID 253722
Institutional Source Beutler Lab
Gene Symbol Clasrp
Ensembl Gene ENSMUSG00000061028
Gene Name CLK4-associating serine/arginine rich protein
Synonyms SWAP2, Sfrs16, Srsf16
MMRRC Submission 040459-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2871 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 19314960-19338411 bp(-) (GRCm39)
Type of Mutation utr 3 prime
DNA Base Change (assembly) C to A at 19319165 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086041] [ENSMUST00000108453] [ENSMUST00000207524] [ENSMUST00000207663] [ENSMUST00000207907] [ENSMUST00000208068]
AlphaFold Q8CFC7
Predicted Effect unknown
Transcript: ENSMUST00000086041
AA Change: R500L
SMART Domains Protein: ENSMUSP00000083205
Gene: ENSMUSG00000061028
AA Change: R500L

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
DRY_EERY 39 171 1.28e-64 SMART
low complexity region 172 212 N/A INTRINSIC
low complexity region 241 260 N/A INTRINSIC
low complexity region 263 283 N/A INTRINSIC
low complexity region 302 324 N/A INTRINSIC
low complexity region 339 368 N/A INTRINSIC
low complexity region 372 446 N/A INTRINSIC
low complexity region 453 476 N/A INTRINSIC
low complexity region 480 532 N/A INTRINSIC
coiled coil region 574 630 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108453
SMART Domains Protein: ENSMUSP00000104093
Gene: ENSMUSG00000011267

DomainStartEndE-ValueType
ZnF_C2H2 138 161 5.07e0 SMART
ZnF_C2H2 212 234 2.05e-2 SMART
ZnF_C2H2 240 262 1.1e-2 SMART
low complexity region 281 295 N/A INTRINSIC
low complexity region 317 329 N/A INTRINSIC
ZnF_C2H2 360 382 1.95e-3 SMART
ZnF_C2H2 388 410 3.39e-3 SMART
ZnF_C2H2 418 441 1.14e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207253
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207264
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207447
Predicted Effect probably benign
Transcript: ENSMUST00000207524
Predicted Effect probably benign
Transcript: ENSMUST00000207663
Predicted Effect unknown
Transcript: ENSMUST00000207907
AA Change: R500L
Predicted Effect unknown
Transcript: ENSMUST00000208068
AA Change: R500L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208464
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208716
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209059
Meta Mutation Damage Score 0.1079 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.2%
  • 10x: 92.4%
  • 20x: 72.0%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene contains serine/arginine (SR) dipeptide repeat domains, and is thought to be involved in the regulation of alternative splicing. This protein is thought to interact with, and be phosphorylated by, Clk4. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,846,002 (GRCm39) C811R possibly damaging Het
Akap8l G A 17: 32,557,416 (GRCm39) T65I possibly damaging Het
Arid4a T A 12: 71,069,034 (GRCm39) probably null Het
Armc2 C T 10: 41,842,696 (GRCm39) probably null Het
Atp6v1g1 A G 4: 63,468,258 (GRCm39) Y87C probably benign Het
Cfap54 A T 10: 92,757,281 (GRCm39) F273I possibly damaging Het
Csmd2 T C 4: 128,451,511 (GRCm39) F113S unknown Het
Cyp4a14 C A 4: 115,344,498 (GRCm39) G456W probably damaging Het
Cyp4a30b A G 4: 115,315,559 (GRCm39) H260R possibly damaging Het
Ddrgk1 T A 2: 130,506,564 (GRCm39) probably benign Het
Dennd2b A T 7: 109,156,637 (GRCm39) Y38N probably benign Het
Dhx57 A T 17: 80,558,805 (GRCm39) D1051E probably benign Het
Eef2 GCCC GCCCC 10: 81,014,601 (GRCm39) probably null Het
Eif4enif1 C T 11: 3,192,586 (GRCm39) P805S probably damaging Het
Eml5 C T 12: 98,831,660 (GRCm39) D433N probably damaging Het
Fan1 A G 7: 64,012,938 (GRCm39) I668T probably benign Het
Frmpd4 A T X: 166,260,243 (GRCm39) D1166E probably benign Het
Ftdc1 A T 16: 58,434,342 (GRCm39) I125K probably benign Het
Gria2 G A 3: 80,609,799 (GRCm39) T670I probably damaging Het
Grid2ip C A 5: 143,343,684 (GRCm39) Q127K probably benign Het
Hdhd2 T C 18: 77,042,702 (GRCm39) F44L probably damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hmcn1 A T 1: 150,614,467 (GRCm39) V1313D possibly damaging Het
Ift172 C T 5: 31,415,205 (GRCm39) V1335I probably benign Het
Ighv2-2 G A 12: 113,552,118 (GRCm39) T40I possibly damaging Het
Kcnk10 T A 12: 98,401,072 (GRCm39) R520S probably benign Het
Kif1c A G 11: 70,614,907 (GRCm39) E567G probably damaging Het
Klf8 A T X: 152,165,678 (GRCm39) E82D probably damaging Het
Kpna7 T C 5: 144,930,745 (GRCm39) T367A probably benign Het
Lpo A G 11: 87,707,350 (GRCm39) I221T possibly damaging Het
Lrrn3 T C 12: 41,502,722 (GRCm39) I532V probably benign Het
Matr3 T A 18: 35,705,349 (GRCm39) S91R probably benign Het
Mki67 G A 7: 135,309,878 (GRCm39) P191L probably benign Het
Mlxip A G 5: 123,590,730 (GRCm39) M878V probably benign Het
Mpp7 G A 18: 7,461,678 (GRCm39) P65L possibly damaging Het
Mroh2a C A 1: 88,183,287 (GRCm39) L1292I probably damaging Het
Msh2 C A 17: 87,993,012 (GRCm39) Q314K possibly damaging Het
Mtor T A 4: 148,624,487 (GRCm39) M2089K probably benign Het
Myo9b G A 8: 71,786,981 (GRCm39) R721Q probably benign Het
Nlrp4b C T 7: 10,444,170 (GRCm39) Q40* probably null Het
Nomo1 C A 7: 45,696,361 (GRCm39) T293N probably damaging Het
Notum A G 11: 120,551,022 (GRCm39) V48A probably benign Het
Npas3 C T 12: 54,114,796 (GRCm39) R542* probably null Het
Or10z1 T C 1: 174,078,092 (GRCm39) S134G probably benign Het
Or13a17 A G 7: 140,271,198 (GRCm39) I127V possibly damaging Het
Or13j1 C A 4: 43,706,458 (GRCm39) V37L probably benign Het
Or5t16 A T 2: 86,819,192 (GRCm39) C109* probably null Het
Ostc T C 3: 130,497,157 (GRCm39) N80S probably damaging Het
Palmd T C 3: 116,717,400 (GRCm39) R366G possibly damaging Het
Parp1 A G 1: 180,401,230 (GRCm39) D45G probably damaging Het
Pcdhga9 T A 18: 37,870,524 (GRCm39) Y118N possibly damaging Het
Pes1 C A 11: 3,926,834 (GRCm39) T372K probably benign Het
Pkp4 C A 2: 59,138,500 (GRCm39) T250K probably benign Het
Plekhg5 T A 4: 152,191,960 (GRCm39) C433S probably benign Het
Plin2 A G 4: 86,586,915 (GRCm39) M1T probably null Het
Prdx4 A G X: 154,123,460 (GRCm39) V15A probably benign Het
Psmb8 T C 17: 34,419,144 (GRCm39) I146T probably damaging Het
Psmd13 A T 7: 140,466,968 (GRCm39) T116S probably damaging Het
Rel T C 11: 23,711,129 (GRCm39) I13V probably benign Het
Reln C T 5: 22,254,789 (GRCm39) V527I possibly damaging Het
Rnf6 T C 5: 146,147,215 (GRCm39) Y601C probably benign Het
Rps6kc1 T C 1: 190,631,766 (GRCm39) I48M probably damaging Het
Sfi1 CCTCTC CCTCTCTC 11: 3,127,419 (GRCm39) probably benign Het
Shoc1 A C 4: 59,093,850 (GRCm39) L226R probably damaging Het
Slc39a8 T A 3: 135,592,554 (GRCm39) probably null Het
Sppl2c C T 11: 104,078,141 (GRCm39) P314S probably benign Het
Tnni3k C T 3: 154,644,387 (GRCm39) probably null Het
Ugt1a1 AT A 1: 88,140,093 (GRCm39) probably null Het
Vmn2r68 A C 7: 84,882,834 (GRCm39) M306R probably benign Het
Vmn2r70 T A 7: 85,208,227 (GRCm39) Y750F probably damaging Het
Vwa7 G A 17: 35,240,218 (GRCm39) M395I probably damaging Het
Zfp53 A T 17: 21,728,340 (GRCm39) E124D probably benign Het
Other mutations in Clasrp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02394:Clasrp APN 7 19,337,179 (GRCm39) missense probably damaging 1.00
clarissa UTSW 7 19,324,173 (GRCm39) missense possibly damaging 0.82
suet UTSW 7 19,320,393 (GRCm39) utr 3 prime probably benign
R0518:Clasrp UTSW 7 19,322,528 (GRCm39) missense probably benign 0.32
R0519:Clasrp UTSW 7 19,318,089 (GRCm39) utr 3 prime probably benign
R0521:Clasrp UTSW 7 19,322,528 (GRCm39) missense probably benign 0.32
R0626:Clasrp UTSW 7 19,318,418 (GRCm39) utr 3 prime probably benign
R0826:Clasrp UTSW 7 19,318,226 (GRCm39) utr 3 prime probably benign
R1918:Clasrp UTSW 7 19,319,188 (GRCm39) nonsense probably null
R2044:Clasrp UTSW 7 19,320,640 (GRCm39) utr 3 prime probably benign
R2256:Clasrp UTSW 7 19,320,510 (GRCm39) utr 3 prime probably benign
R2257:Clasrp UTSW 7 19,320,510 (GRCm39) utr 3 prime probably benign
R2870:Clasrp UTSW 7 19,319,165 (GRCm39) utr 3 prime probably benign
R2870:Clasrp UTSW 7 19,319,165 (GRCm39) utr 3 prime probably benign
R2871:Clasrp UTSW 7 19,319,165 (GRCm39) utr 3 prime probably benign
R2940:Clasrp UTSW 7 19,319,165 (GRCm39) utr 3 prime probably benign
R3408:Clasrp UTSW 7 19,319,165 (GRCm39) utr 3 prime probably benign
R3691:Clasrp UTSW 7 19,319,165 (GRCm39) utr 3 prime probably benign
R4168:Clasrp UTSW 7 19,315,079 (GRCm39) unclassified probably benign
R4496:Clasrp UTSW 7 19,319,165 (GRCm39) utr 3 prime probably benign
R4505:Clasrp UTSW 7 19,319,165 (GRCm39) utr 3 prime probably benign
R4507:Clasrp UTSW 7 19,319,165 (GRCm39) utr 3 prime probably benign
R4572:Clasrp UTSW 7 19,318,389 (GRCm39) splice site probably null
R4753:Clasrp UTSW 7 19,328,865 (GRCm39) missense probably damaging 1.00
R4871:Clasrp UTSW 7 19,324,173 (GRCm39) missense possibly damaging 0.82
R4938:Clasrp UTSW 7 19,318,703 (GRCm39) splice site probably null
R5538:Clasrp UTSW 7 19,318,707 (GRCm39) utr 3 prime probably benign
R5582:Clasrp UTSW 7 19,320,781 (GRCm39) missense probably damaging 0.97
R5615:Clasrp UTSW 7 19,320,372 (GRCm39) utr 3 prime probably benign
R5794:Clasrp UTSW 7 19,325,034 (GRCm39) missense probably damaging 0.99
R5944:Clasrp UTSW 7 19,328,431 (GRCm39) missense probably damaging 1.00
R6102:Clasrp UTSW 7 19,320,393 (GRCm39) utr 3 prime probably benign
R6171:Clasrp UTSW 7 19,318,747 (GRCm39) splice site probably benign
R6485:Clasrp UTSW 7 19,320,294 (GRCm39) utr 3 prime probably benign
R6600:Clasrp UTSW 7 19,324,207 (GRCm39) nonsense probably null
R7383:Clasrp UTSW 7 19,319,198 (GRCm39) missense unknown
R7719:Clasrp UTSW 7 19,321,769 (GRCm39) missense probably damaging 0.99
R7750:Clasrp UTSW 7 19,318,516 (GRCm39) makesense probably null
R7808:Clasrp UTSW 7 19,322,671 (GRCm39) splice site probably null
R8192:Clasrp UTSW 7 19,329,387 (GRCm39) missense possibly damaging 0.83
R8820:Clasrp UTSW 7 19,320,362 (GRCm39) missense unknown
R8821:Clasrp UTSW 7 19,320,362 (GRCm39) missense unknown
R8924:Clasrp UTSW 7 19,318,232 (GRCm39) missense unknown
R9471:Clasrp UTSW 7 19,319,172 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AATTTCATCAGGGCTCCCTC -3'
(R):5'- AAAGTGCTGGACTCTGCAGG -3'

Sequencing Primer
(F):5'- ATTTCATCAGGGCTCCCTCAGAAC -3'
(R):5'- CAGGAGGCCTAGCGATTTG -3'
Posted On 2014-12-04