Incidental Mutation 'R2871:Vmn2r68'
ID 253726
Institutional Source Beutler Lab
Gene Symbol Vmn2r68
Ensembl Gene ENSMUSG00000096861
Gene Name vomeronasal 2, receptor 68
Synonyms EG620697, Vmn2r68-ps
MMRRC Submission 040459-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.085) question?
Stock # R2871 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 84870726-84886912 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 84882834 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Arginine at position 306 (M306R)
Ref Sequence ENSEMBL: ENSMUSP00000129411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061074]
AlphaFold L7N2B3
Predicted Effect probably benign
Transcript: ENSMUST00000061074
AA Change: M306R

PolyPhen 2 Score 0.249 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000129411
Gene: ENSMUSG00000096861
AA Change: M306R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 463 4.5e-28 PFAM
Pfam:NCD3G 507 559 1.1e-18 PFAM
Pfam:7tm_3 589 827 3.7e-53 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.2%
  • 10x: 92.4%
  • 20x: 72.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,846,002 (GRCm39) C811R possibly damaging Het
Akap8l G A 17: 32,557,416 (GRCm39) T65I possibly damaging Het
Arid4a T A 12: 71,069,034 (GRCm39) probably null Het
Armc2 C T 10: 41,842,696 (GRCm39) probably null Het
Atp6v1g1 A G 4: 63,468,258 (GRCm39) Y87C probably benign Het
Cfap54 A T 10: 92,757,281 (GRCm39) F273I possibly damaging Het
Clasrp C A 7: 19,319,165 (GRCm39) probably benign Het
Csmd2 T C 4: 128,451,511 (GRCm39) F113S unknown Het
Cyp4a14 C A 4: 115,344,498 (GRCm39) G456W probably damaging Het
Cyp4a30b A G 4: 115,315,559 (GRCm39) H260R possibly damaging Het
Ddrgk1 T A 2: 130,506,564 (GRCm39) probably benign Het
Dennd2b A T 7: 109,156,637 (GRCm39) Y38N probably benign Het
Dhx57 A T 17: 80,558,805 (GRCm39) D1051E probably benign Het
Eef2 GCCC GCCCC 10: 81,014,601 (GRCm39) probably null Het
Eif4enif1 C T 11: 3,192,586 (GRCm39) P805S probably damaging Het
Eml5 C T 12: 98,831,660 (GRCm39) D433N probably damaging Het
Fan1 A G 7: 64,012,938 (GRCm39) I668T probably benign Het
Frmpd4 A T X: 166,260,243 (GRCm39) D1166E probably benign Het
Ftdc1 A T 16: 58,434,342 (GRCm39) I125K probably benign Het
Gria2 G A 3: 80,609,799 (GRCm39) T670I probably damaging Het
Grid2ip C A 5: 143,343,684 (GRCm39) Q127K probably benign Het
Hdhd2 T C 18: 77,042,702 (GRCm39) F44L probably damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hmcn1 A T 1: 150,614,467 (GRCm39) V1313D possibly damaging Het
Ift172 C T 5: 31,415,205 (GRCm39) V1335I probably benign Het
Ighv2-2 G A 12: 113,552,118 (GRCm39) T40I possibly damaging Het
Kcnk10 T A 12: 98,401,072 (GRCm39) R520S probably benign Het
Kif1c A G 11: 70,614,907 (GRCm39) E567G probably damaging Het
Klf8 A T X: 152,165,678 (GRCm39) E82D probably damaging Het
Kpna7 T C 5: 144,930,745 (GRCm39) T367A probably benign Het
Lpo A G 11: 87,707,350 (GRCm39) I221T possibly damaging Het
Lrrn3 T C 12: 41,502,722 (GRCm39) I532V probably benign Het
Matr3 T A 18: 35,705,349 (GRCm39) S91R probably benign Het
Mki67 G A 7: 135,309,878 (GRCm39) P191L probably benign Het
Mlxip A G 5: 123,590,730 (GRCm39) M878V probably benign Het
Mpp7 G A 18: 7,461,678 (GRCm39) P65L possibly damaging Het
Mroh2a C A 1: 88,183,287 (GRCm39) L1292I probably damaging Het
Msh2 C A 17: 87,993,012 (GRCm39) Q314K possibly damaging Het
Mtor T A 4: 148,624,487 (GRCm39) M2089K probably benign Het
Myo9b G A 8: 71,786,981 (GRCm39) R721Q probably benign Het
Nlrp4b C T 7: 10,444,170 (GRCm39) Q40* probably null Het
Nomo1 C A 7: 45,696,361 (GRCm39) T293N probably damaging Het
Notum A G 11: 120,551,022 (GRCm39) V48A probably benign Het
Npas3 C T 12: 54,114,796 (GRCm39) R542* probably null Het
Or10z1 T C 1: 174,078,092 (GRCm39) S134G probably benign Het
Or13a17 A G 7: 140,271,198 (GRCm39) I127V possibly damaging Het
Or13j1 C A 4: 43,706,458 (GRCm39) V37L probably benign Het
Or5t16 A T 2: 86,819,192 (GRCm39) C109* probably null Het
Ostc T C 3: 130,497,157 (GRCm39) N80S probably damaging Het
Palmd T C 3: 116,717,400 (GRCm39) R366G possibly damaging Het
Parp1 A G 1: 180,401,230 (GRCm39) D45G probably damaging Het
Pcdhga9 T A 18: 37,870,524 (GRCm39) Y118N possibly damaging Het
Pes1 C A 11: 3,926,834 (GRCm39) T372K probably benign Het
Pkp4 C A 2: 59,138,500 (GRCm39) T250K probably benign Het
Plekhg5 T A 4: 152,191,960 (GRCm39) C433S probably benign Het
Plin2 A G 4: 86,586,915 (GRCm39) M1T probably null Het
Prdx4 A G X: 154,123,460 (GRCm39) V15A probably benign Het
Psmb8 T C 17: 34,419,144 (GRCm39) I146T probably damaging Het
Psmd13 A T 7: 140,466,968 (GRCm39) T116S probably damaging Het
Rel T C 11: 23,711,129 (GRCm39) I13V probably benign Het
Reln C T 5: 22,254,789 (GRCm39) V527I possibly damaging Het
Rnf6 T C 5: 146,147,215 (GRCm39) Y601C probably benign Het
Rps6kc1 T C 1: 190,631,766 (GRCm39) I48M probably damaging Het
Sfi1 CCTCTC CCTCTCTC 11: 3,127,419 (GRCm39) probably benign Het
Shoc1 A C 4: 59,093,850 (GRCm39) L226R probably damaging Het
Slc39a8 T A 3: 135,592,554 (GRCm39) probably null Het
Sppl2c C T 11: 104,078,141 (GRCm39) P314S probably benign Het
Tnni3k C T 3: 154,644,387 (GRCm39) probably null Het
Ugt1a1 AT A 1: 88,140,093 (GRCm39) probably null Het
Vmn2r70 T A 7: 85,208,227 (GRCm39) Y750F probably damaging Het
Vwa7 G A 17: 35,240,218 (GRCm39) M395I probably damaging Het
Zfp53 A T 17: 21,728,340 (GRCm39) E124D probably benign Het
Other mutations in Vmn2r68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Vmn2r68 APN 7 84,886,819 (GRCm39) missense probably benign
IGL01477:Vmn2r68 APN 7 84,882,691 (GRCm39) missense probably damaging 1.00
IGL01600:Vmn2r68 APN 7 84,871,468 (GRCm39) missense probably benign 0.39
IGL01979:Vmn2r68 APN 7 84,871,325 (GRCm39) missense probably benign
IGL01999:Vmn2r68 APN 7 84,871,439 (GRCm39) missense probably damaging 1.00
IGL02269:Vmn2r68 APN 7 84,870,947 (GRCm39) missense possibly damaging 0.84
IGL02517:Vmn2r68 APN 7 84,871,153 (GRCm39) nonsense probably null
IGL02827:Vmn2r68 APN 7 84,886,800 (GRCm39) missense probably damaging 1.00
IGL02852:Vmn2r68 APN 7 84,882,595 (GRCm39) missense probably damaging 1.00
IGL02982:Vmn2r68 APN 7 84,883,649 (GRCm39) missense probably benign 0.12
IGL03099:Vmn2r68 APN 7 84,871,448 (GRCm39) nonsense probably null
IGL03166:Vmn2r68 APN 7 84,871,331 (GRCm39) missense probably benign 0.01
IGL03168:Vmn2r68 APN 7 84,870,972 (GRCm39) missense probably damaging 1.00
IGL03243:Vmn2r68 APN 7 84,882,963 (GRCm39) missense possibly damaging 0.66
F5770:Vmn2r68 UTSW 7 84,871,088 (GRCm39) missense probably benign 0.01
R0280:Vmn2r68 UTSW 7 84,882,466 (GRCm39) critical splice donor site probably null
R0280:Vmn2r68 UTSW 7 84,882,457 (GRCm39) splice site probably benign
R0281:Vmn2r68 UTSW 7 84,882,466 (GRCm39) critical splice donor site probably null
R0281:Vmn2r68 UTSW 7 84,882,457 (GRCm39) splice site probably benign
R0348:Vmn2r68 UTSW 7 84,870,884 (GRCm39) missense possibly damaging 0.50
R0390:Vmn2r68 UTSW 7 84,882,466 (GRCm39) critical splice donor site probably null
R0390:Vmn2r68 UTSW 7 84,882,457 (GRCm39) splice site probably benign
R0722:Vmn2r68 UTSW 7 84,870,794 (GRCm39) missense possibly damaging 0.95
R1129:Vmn2r68 UTSW 7 84,886,712 (GRCm39) splice site probably null
R1136:Vmn2r68 UTSW 7 84,871,549 (GRCm39) missense possibly damaging 0.81
R1319:Vmn2r68 UTSW 7 84,881,700 (GRCm39) missense probably damaging 0.96
R1614:Vmn2r68 UTSW 7 84,870,946 (GRCm39) missense possibly damaging 0.93
R1682:Vmn2r68 UTSW 7 84,882,574 (GRCm39) missense possibly damaging 0.68
R1837:Vmn2r68 UTSW 7 84,882,886 (GRCm39) missense probably damaging 0.96
R1893:Vmn2r68 UTSW 7 84,883,867 (GRCm39) nonsense probably null
R1908:Vmn2r68 UTSW 7 84,883,260 (GRCm39) missense probably benign 0.09
R1909:Vmn2r68 UTSW 7 84,883,260 (GRCm39) missense probably benign 0.09
R1951:Vmn2r68 UTSW 7 84,883,102 (GRCm39) missense probably damaging 1.00
R2177:Vmn2r68 UTSW 7 84,871,123 (GRCm39) missense probably benign 0.01
R2178:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R2185:Vmn2r68 UTSW 7 84,882,901 (GRCm39) nonsense probably null
R2188:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R2282:Vmn2r68 UTSW 7 84,870,859 (GRCm39) missense possibly damaging 0.65
R2567:Vmn2r68 UTSW 7 84,883,803 (GRCm39) missense probably benign
R2869:Vmn2r68 UTSW 7 84,882,834 (GRCm39) missense probably benign 0.25
R2869:Vmn2r68 UTSW 7 84,882,834 (GRCm39) missense probably benign 0.25
R2870:Vmn2r68 UTSW 7 84,882,834 (GRCm39) missense probably benign 0.25
R2870:Vmn2r68 UTSW 7 84,882,834 (GRCm39) missense probably benign 0.25
R2871:Vmn2r68 UTSW 7 84,882,834 (GRCm39) missense probably benign 0.25
R2873:Vmn2r68 UTSW 7 84,882,834 (GRCm39) missense probably benign 0.25
R2874:Vmn2r68 UTSW 7 84,882,834 (GRCm39) missense probably benign 0.25
R3149:Vmn2r68 UTSW 7 84,886,875 (GRCm39) missense probably benign 0.00
R3401:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R3978:Vmn2r68 UTSW 7 84,881,670 (GRCm39) missense probably benign 0.00
R4399:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R4401:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R4421:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R4478:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R4479:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R4495:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R4628:Vmn2r68 UTSW 7 84,883,673 (GRCm39) missense probably benign 0.00
R4649:Vmn2r68 UTSW 7 84,870,743 (GRCm39) missense probably benign
R4654:Vmn2r68 UTSW 7 84,882,769 (GRCm39) nonsense probably null
R4793:Vmn2r68 UTSW 7 84,883,648 (GRCm39) missense probably benign 0.01
R5007:Vmn2r68 UTSW 7 84,881,622 (GRCm39) missense probably benign
R5021:Vmn2r68 UTSW 7 84,882,942 (GRCm39) missense possibly damaging 0.62
R5082:Vmn2r68 UTSW 7 84,883,076 (GRCm39) missense probably benign 0.12
R5177:Vmn2r68 UTSW 7 84,871,199 (GRCm39) missense probably damaging 0.99
R5221:Vmn2r68 UTSW 7 84,871,085 (GRCm39) missense probably damaging 1.00
R5514:Vmn2r68 UTSW 7 84,886,767 (GRCm39) missense possibly damaging 0.92
R5521:Vmn2r68 UTSW 7 84,882,926 (GRCm39) missense probably benign 0.03
R5563:Vmn2r68 UTSW 7 84,871,283 (GRCm39) missense probably damaging 1.00
R5664:Vmn2r68 UTSW 7 84,882,978 (GRCm39) missense probably benign 0.02
R5829:Vmn2r68 UTSW 7 84,886,812 (GRCm39) missense probably benign 0.00
R6016:Vmn2r68 UTSW 7 84,871,453 (GRCm39) missense probably damaging 0.99
R6356:Vmn2r68 UTSW 7 84,883,048 (GRCm39) missense possibly damaging 0.85
R6413:Vmn2r68 UTSW 7 84,870,973 (GRCm39) missense probably damaging 1.00
R6418:Vmn2r68 UTSW 7 84,882,915 (GRCm39) missense probably benign
R6699:Vmn2r68 UTSW 7 84,881,583 (GRCm39) missense possibly damaging 0.58
R7287:Vmn2r68 UTSW 7 84,871,460 (GRCm39) missense probably benign 0.33
R7319:Vmn2r68 UTSW 7 84,883,042 (GRCm39) missense probably benign
R7374:Vmn2r68 UTSW 7 84,881,607 (GRCm39) missense possibly damaging 0.66
R7585:Vmn2r68 UTSW 7 84,881,587 (GRCm39) missense probably damaging 1.00
R7605:Vmn2r68 UTSW 7 84,883,116 (GRCm39) missense probably benign 0.01
R7892:Vmn2r68 UTSW 7 84,883,722 (GRCm39) missense probably benign
R7979:Vmn2r68 UTSW 7 84,883,625 (GRCm39) critical splice donor site probably null
R8177:Vmn2r68 UTSW 7 84,871,422 (GRCm39) nonsense probably null
R8349:Vmn2r68 UTSW 7 84,882,785 (GRCm39) missense probably damaging 1.00
R8378:Vmn2r68 UTSW 7 84,871,108 (GRCm39) missense probably benign 0.00
R8397:Vmn2r68 UTSW 7 84,886,722 (GRCm39) missense possibly damaging 0.71
R8449:Vmn2r68 UTSW 7 84,882,785 (GRCm39) missense probably damaging 1.00
R8543:Vmn2r68 UTSW 7 84,883,648 (GRCm39) missense probably benign 0.01
R8680:Vmn2r68 UTSW 7 84,871,321 (GRCm39) missense possibly damaging 0.68
R9056:Vmn2r68 UTSW 7 84,871,420 (GRCm39) missense possibly damaging 0.71
R9342:Vmn2r68 UTSW 7 84,882,993 (GRCm39) missense probably benign 0.39
R9734:Vmn2r68 UTSW 7 84,882,757 (GRCm39) missense possibly damaging 0.54
V7581:Vmn2r68 UTSW 7 84,871,088 (GRCm39) missense probably benign 0.01
Z1176:Vmn2r68 UTSW 7 84,871,289 (GRCm39) missense probably benign 0.27
Z1176:Vmn2r68 UTSW 7 84,870,941 (GRCm39) missense probably damaging 1.00
Z1176:Vmn2r68 UTSW 7 84,871,307 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TCCAAGTGGTGTCATGAATAACC -3'
(R):5'- GCATGGCCCATAAAGAGTTTC -3'

Sequencing Primer
(F):5'- GGTTGGACAATTCTTCAGCTTC -3'
(R):5'- CATGGCCCATAAAGAGTTTCAAAGG -3'
Posted On 2014-12-04