Incidental Mutation 'R2871:Dennd2b'
ID 253730
Institutional Source Beutler Lab
Gene Symbol Dennd2b
Ensembl Gene ENSMUSG00000031024
Gene Name DENN domain containing 2B
Synonyms Denn2b, 2610305K15Rik, St5, 2010004M01Rik
MMRRC Submission 040459-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.390) question?
Stock # R2871 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 109123118-109302812 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 109156637 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 38 (Y38N)
Ref Sequence ENSEMBL: ENSMUSP00000078264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077909] [ENSMUST00000079282] [ENSMUST00000084738] [ENSMUST00000168005] [ENSMUST00000207394] [ENSMUST00000207745] [ENSMUST00000208583]
AlphaFold Q924W7
Predicted Effect probably benign
Transcript: ENSMUST00000077909
AA Change: Y38N

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000077067
Gene: ENSMUSG00000031024
AA Change: Y38N

DomainStartEndE-ValueType
low complexity region 28 46 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
low complexity region 314 326 N/A INTRINSIC
low complexity region 327 348 N/A INTRINSIC
low complexity region 365 379 N/A INTRINSIC
low complexity region 407 426 N/A INTRINSIC
low complexity region 577 609 N/A INTRINSIC
low complexity region 624 638 N/A INTRINSIC
low complexity region 645 656 N/A INTRINSIC
uDENN 690 781 1.16e-30 SMART
DENN 788 972 7.84e-78 SMART
low complexity region 1007 1014 N/A INTRINSIC
dDENN 1019 1086 3.12e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000079282
AA Change: Y38N

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000078264
Gene: ENSMUSG00000031024
AA Change: Y38N

DomainStartEndE-ValueType
low complexity region 28 46 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
low complexity region 314 326 N/A INTRINSIC
low complexity region 327 348 N/A INTRINSIC
low complexity region 365 379 N/A INTRINSIC
low complexity region 407 426 N/A INTRINSIC
low complexity region 577 609 N/A INTRINSIC
low complexity region 624 638 N/A INTRINSIC
low complexity region 645 656 N/A INTRINSIC
uDENN 690 781 1.16e-30 SMART
DENN 788 972 7.84e-78 SMART
low complexity region 1007 1014 N/A INTRINSIC
dDENN 1019 1086 3.12e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084738
SMART Domains Protein: ENSMUSP00000081789
Gene: ENSMUSG00000031024

DomainStartEndE-ValueType
low complexity region 160 192 N/A INTRINSIC
low complexity region 207 221 N/A INTRINSIC
low complexity region 228 239 N/A INTRINSIC
uDENN 273 364 1.16e-30 SMART
DENN 371 555 7.84e-78 SMART
low complexity region 590 597 N/A INTRINSIC
dDENN 602 669 3.12e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168005
SMART Domains Protein: ENSMUSP00000130119
Gene: ENSMUSG00000031024

DomainStartEndE-ValueType
low complexity region 160 192 N/A INTRINSIC
low complexity region 207 221 N/A INTRINSIC
low complexity region 228 239 N/A INTRINSIC
uDENN 273 364 1.16e-30 SMART
DENN 371 555 7.84e-78 SMART
low complexity region 590 597 N/A INTRINSIC
dDENN 602 669 3.12e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207394
AA Change: Y38N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000207745
Predicted Effect probably benign
Transcript: ENSMUST00000208583
AA Change: Y38N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208981
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208557
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.2%
  • 10x: 92.4%
  • 20x: 72.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its ability to suppress the tumorigenicity of Hela cells in nude mice. The protein encoded by this gene contains a C-terminal region that shares similarity with the Rab 3 family of small GTP binding proteins. This protein preferentially binds to the SH3 domain of c-Abl kinase, and acts as a regulator of MAPK1/ERK2 kinase, which may contribute to its ability to reduce the tumorigenic phenotype in cells. Three alternatively spliced transcript variants of this gene encoding distinct isoforms are identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,846,002 (GRCm39) C811R possibly damaging Het
Akap8l G A 17: 32,557,416 (GRCm39) T65I possibly damaging Het
Arid4a T A 12: 71,069,034 (GRCm39) probably null Het
Armc2 C T 10: 41,842,696 (GRCm39) probably null Het
Atp6v1g1 A G 4: 63,468,258 (GRCm39) Y87C probably benign Het
Cfap54 A T 10: 92,757,281 (GRCm39) F273I possibly damaging Het
Clasrp C A 7: 19,319,165 (GRCm39) probably benign Het
Csmd2 T C 4: 128,451,511 (GRCm39) F113S unknown Het
Cyp4a14 C A 4: 115,344,498 (GRCm39) G456W probably damaging Het
Cyp4a30b A G 4: 115,315,559 (GRCm39) H260R possibly damaging Het
Ddrgk1 T A 2: 130,506,564 (GRCm39) probably benign Het
Dhx57 A T 17: 80,558,805 (GRCm39) D1051E probably benign Het
Eef2 GCCC GCCCC 10: 81,014,601 (GRCm39) probably null Het
Eif4enif1 C T 11: 3,192,586 (GRCm39) P805S probably damaging Het
Eml5 C T 12: 98,831,660 (GRCm39) D433N probably damaging Het
Fan1 A G 7: 64,012,938 (GRCm39) I668T probably benign Het
Frmpd4 A T X: 166,260,243 (GRCm39) D1166E probably benign Het
Ftdc1 A T 16: 58,434,342 (GRCm39) I125K probably benign Het
Gria2 G A 3: 80,609,799 (GRCm39) T670I probably damaging Het
Grid2ip C A 5: 143,343,684 (GRCm39) Q127K probably benign Het
Hdhd2 T C 18: 77,042,702 (GRCm39) F44L probably damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hmcn1 A T 1: 150,614,467 (GRCm39) V1313D possibly damaging Het
Ift172 C T 5: 31,415,205 (GRCm39) V1335I probably benign Het
Ighv2-2 G A 12: 113,552,118 (GRCm39) T40I possibly damaging Het
Kcnk10 T A 12: 98,401,072 (GRCm39) R520S probably benign Het
Kif1c A G 11: 70,614,907 (GRCm39) E567G probably damaging Het
Klf8 A T X: 152,165,678 (GRCm39) E82D probably damaging Het
Kpna7 T C 5: 144,930,745 (GRCm39) T367A probably benign Het
Lpo A G 11: 87,707,350 (GRCm39) I221T possibly damaging Het
Lrrn3 T C 12: 41,502,722 (GRCm39) I532V probably benign Het
Matr3 T A 18: 35,705,349 (GRCm39) S91R probably benign Het
Mki67 G A 7: 135,309,878 (GRCm39) P191L probably benign Het
Mlxip A G 5: 123,590,730 (GRCm39) M878V probably benign Het
Mpp7 G A 18: 7,461,678 (GRCm39) P65L possibly damaging Het
Mroh2a C A 1: 88,183,287 (GRCm39) L1292I probably damaging Het
Msh2 C A 17: 87,993,012 (GRCm39) Q314K possibly damaging Het
Mtor T A 4: 148,624,487 (GRCm39) M2089K probably benign Het
Myo9b G A 8: 71,786,981 (GRCm39) R721Q probably benign Het
Nlrp4b C T 7: 10,444,170 (GRCm39) Q40* probably null Het
Nomo1 C A 7: 45,696,361 (GRCm39) T293N probably damaging Het
Notum A G 11: 120,551,022 (GRCm39) V48A probably benign Het
Npas3 C T 12: 54,114,796 (GRCm39) R542* probably null Het
Or10z1 T C 1: 174,078,092 (GRCm39) S134G probably benign Het
Or13a17 A G 7: 140,271,198 (GRCm39) I127V possibly damaging Het
Or13j1 C A 4: 43,706,458 (GRCm39) V37L probably benign Het
Or5t16 A T 2: 86,819,192 (GRCm39) C109* probably null Het
Ostc T C 3: 130,497,157 (GRCm39) N80S probably damaging Het
Palmd T C 3: 116,717,400 (GRCm39) R366G possibly damaging Het
Parp1 A G 1: 180,401,230 (GRCm39) D45G probably damaging Het
Pcdhga9 T A 18: 37,870,524 (GRCm39) Y118N possibly damaging Het
Pes1 C A 11: 3,926,834 (GRCm39) T372K probably benign Het
Pkp4 C A 2: 59,138,500 (GRCm39) T250K probably benign Het
Plekhg5 T A 4: 152,191,960 (GRCm39) C433S probably benign Het
Plin2 A G 4: 86,586,915 (GRCm39) M1T probably null Het
Prdx4 A G X: 154,123,460 (GRCm39) V15A probably benign Het
Psmb8 T C 17: 34,419,144 (GRCm39) I146T probably damaging Het
Psmd13 A T 7: 140,466,968 (GRCm39) T116S probably damaging Het
Rel T C 11: 23,711,129 (GRCm39) I13V probably benign Het
Reln C T 5: 22,254,789 (GRCm39) V527I possibly damaging Het
Rnf6 T C 5: 146,147,215 (GRCm39) Y601C probably benign Het
Rps6kc1 T C 1: 190,631,766 (GRCm39) I48M probably damaging Het
Sfi1 CCTCTC CCTCTCTC 11: 3,127,419 (GRCm39) probably benign Het
Shoc1 A C 4: 59,093,850 (GRCm39) L226R probably damaging Het
Slc39a8 T A 3: 135,592,554 (GRCm39) probably null Het
Sppl2c C T 11: 104,078,141 (GRCm39) P314S probably benign Het
Tnni3k C T 3: 154,644,387 (GRCm39) probably null Het
Ugt1a1 AT A 1: 88,140,093 (GRCm39) probably null Het
Vmn2r68 A C 7: 84,882,834 (GRCm39) M306R probably benign Het
Vmn2r70 T A 7: 85,208,227 (GRCm39) Y750F probably damaging Het
Vwa7 G A 17: 35,240,218 (GRCm39) M395I probably damaging Het
Zfp53 A T 17: 21,728,340 (GRCm39) E124D probably benign Het
Other mutations in Dennd2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Dennd2b APN 7 109,126,915 (GRCm39) missense possibly damaging 0.71
IGL01132:Dennd2b APN 7 109,169,212 (GRCm39) splice site probably null
IGL01288:Dennd2b APN 7 109,139,029 (GRCm39) missense probably damaging 0.96
IGL01645:Dennd2b APN 7 109,126,841 (GRCm39) nonsense probably null
IGL01714:Dennd2b APN 7 109,169,269 (GRCm39) missense probably damaging 0.99
IGL02021:Dennd2b APN 7 109,156,579 (GRCm39) missense probably damaging 1.00
IGL02302:Dennd2b APN 7 109,124,538 (GRCm39) missense probably damaging 1.00
IGL02496:Dennd2b APN 7 109,155,442 (GRCm39) missense possibly damaging 0.83
IGL02795:Dennd2b APN 7 109,155,571 (GRCm39) missense probably damaging 1.00
Bucolic UTSW 7 109,124,755 (GRCm39) nonsense probably null
Halcyon UTSW 7 109,156,000 (GRCm39) nonsense probably null
FR4340:Dennd2b UTSW 7 109,156,128 (GRCm39) unclassified probably benign
FR4737:Dennd2b UTSW 7 109,156,128 (GRCm39) unclassified probably benign
PIT4466001:Dennd2b UTSW 7 109,130,337 (GRCm39) missense probably damaging 1.00
PIT4469001:Dennd2b UTSW 7 109,130,337 (GRCm39) missense probably damaging 1.00
PIT4472001:Dennd2b UTSW 7 109,130,337 (GRCm39) missense probably damaging 1.00
R0024:Dennd2b UTSW 7 109,123,866 (GRCm39) missense probably damaging 1.00
R0124:Dennd2b UTSW 7 109,141,718 (GRCm39) missense possibly damaging 0.66
R0125:Dennd2b UTSW 7 109,155,545 (GRCm39) missense probably benign 0.19
R0365:Dennd2b UTSW 7 109,138,156 (GRCm39) missense probably damaging 1.00
R0491:Dennd2b UTSW 7 109,156,411 (GRCm39) missense probably benign 0.45
R0534:Dennd2b UTSW 7 109,140,635 (GRCm39) missense probably damaging 1.00
R0662:Dennd2b UTSW 7 109,156,633 (GRCm39) missense probably damaging 1.00
R0743:Dennd2b UTSW 7 109,156,552 (GRCm39) missense probably damaging 1.00
R0772:Dennd2b UTSW 7 109,141,527 (GRCm39) splice site probably null
R0774:Dennd2b UTSW 7 109,141,527 (GRCm39) splice site probably null
R0787:Dennd2b UTSW 7 109,124,827 (GRCm39) missense possibly damaging 0.94
R0884:Dennd2b UTSW 7 109,156,552 (GRCm39) missense probably damaging 1.00
R1518:Dennd2b UTSW 7 109,156,562 (GRCm39) missense probably damaging 1.00
R1908:Dennd2b UTSW 7 109,124,533 (GRCm39) nonsense probably null
R1909:Dennd2b UTSW 7 109,124,533 (GRCm39) nonsense probably null
R2232:Dennd2b UTSW 7 109,156,414 (GRCm39) missense probably benign
R2358:Dennd2b UTSW 7 109,155,653 (GRCm39) missense probably benign 0.01
R2847:Dennd2b UTSW 7 109,124,544 (GRCm39) missense probably damaging 1.00
R2869:Dennd2b UTSW 7 109,156,637 (GRCm39) missense probably benign 0.01
R2869:Dennd2b UTSW 7 109,156,637 (GRCm39) missense probably benign 0.01
R2870:Dennd2b UTSW 7 109,156,637 (GRCm39) missense probably benign 0.01
R2870:Dennd2b UTSW 7 109,156,637 (GRCm39) missense probably benign 0.01
R2871:Dennd2b UTSW 7 109,156,637 (GRCm39) missense probably benign 0.01
R2873:Dennd2b UTSW 7 109,156,637 (GRCm39) missense probably benign 0.01
R2874:Dennd2b UTSW 7 109,156,637 (GRCm39) missense probably benign 0.01
R4534:Dennd2b UTSW 7 109,130,363 (GRCm39) missense probably damaging 1.00
R4536:Dennd2b UTSW 7 109,130,363 (GRCm39) missense probably damaging 1.00
R4559:Dennd2b UTSW 7 109,124,785 (GRCm39) missense probably damaging 1.00
R4798:Dennd2b UTSW 7 109,156,240 (GRCm39) missense probably damaging 0.99
R4846:Dennd2b UTSW 7 109,156,043 (GRCm39) nonsense probably null
R5110:Dennd2b UTSW 7 109,141,697 (GRCm39) missense probably benign 0.02
R5181:Dennd2b UTSW 7 109,155,997 (GRCm39) missense probably benign
R5268:Dennd2b UTSW 7 109,156,519 (GRCm39) missense probably benign
R5403:Dennd2b UTSW 7 109,156,112 (GRCm39) missense probably damaging 1.00
R5836:Dennd2b UTSW 7 109,140,552 (GRCm39) missense possibly damaging 0.78
R5932:Dennd2b UTSW 7 109,169,223 (GRCm39) missense probably damaging 1.00
R5937:Dennd2b UTSW 7 109,156,478 (GRCm39) missense possibly damaging 0.86
R6180:Dennd2b UTSW 7 109,156,095 (GRCm39) missense probably benign 0.11
R6741:Dennd2b UTSW 7 109,144,304 (GRCm39) missense possibly damaging 0.95
R6781:Dennd2b UTSW 7 109,124,511 (GRCm39) missense possibly damaging 0.83
R7086:Dennd2b UTSW 7 109,124,781 (GRCm39) missense probably damaging 1.00
R7466:Dennd2b UTSW 7 109,124,553 (GRCm39) missense probably damaging 1.00
R7644:Dennd2b UTSW 7 109,156,000 (GRCm39) nonsense probably null
R8354:Dennd2b UTSW 7 109,124,755 (GRCm39) nonsense probably null
R8745:Dennd2b UTSW 7 109,156,279 (GRCm39) missense probably benign 0.02
R8859:Dennd2b UTSW 7 109,123,863 (GRCm39) missense probably damaging 1.00
R9016:Dennd2b UTSW 7 109,139,642 (GRCm39) missense possibly damaging 0.84
R9178:Dennd2b UTSW 7 109,156,291 (GRCm39) missense probably benign 0.31
R9361:Dennd2b UTSW 7 109,126,991 (GRCm39) missense probably damaging 1.00
R9564:Dennd2b UTSW 7 109,125,536 (GRCm39) missense probably damaging 1.00
R9595:Dennd2b UTSW 7 109,155,973 (GRCm39) missense probably damaging 0.96
RF062:Dennd2b UTSW 7 109,156,153 (GRCm39) unclassified probably benign
X0067:Dennd2b UTSW 7 109,155,447 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCTTGAGGGTACAAATGGGTG -3'
(R):5'- TTGGCCTGCCGTGACTAAAG -3'

Sequencing Primer
(F):5'- ACAAATGGGTGGTGAGGTTTC -3'
(R):5'- GTAGCCAGTGATGACCTTGAACTC -3'
Posted On 2014-12-04