Incidental Mutation 'R2871:Mki67'
ID 253732
Institutional Source Beutler Lab
Gene Symbol Mki67
Ensembl Gene ENSMUSG00000031004
Gene Name antigen identified by monoclonal antibody Ki 67
Synonyms D630048A14Rik, Ki-67, Ki67
MMRRC Submission 040459-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.872) question?
Stock # R2871 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 135291513-135318090 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 135309878 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 191 (P191L)
Ref Sequence ENSEMBL: ENSMUSP00000033310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033310]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000033310
AA Change: P191L

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000033310
Gene: ENSMUSG00000031004
AA Change: P191L

DomainStartEndE-ValueType
FHA 26 76 1.03e-11 SMART
Pfam:PP1_bind 462 519 2.8e-20 PFAM
low complexity region 535 545 N/A INTRINSIC
low complexity region 869 882 N/A INTRINSIC
Pfam:K167R 889 982 1.5e-9 PFAM
K167R 993 1102 2.01e-39 SMART
K167R 1107 1217 1.87e-57 SMART
K167R 1228 1337 1.33e-53 SMART
K167R 1348 1451 6.57e-44 SMART
K167R 1462 1570 9.09e-38 SMART
K167R 1580 1686 5.02e-40 SMART
K167R 1697 1807 9.6e-37 SMART
K167R 1818 1926 5.94e-51 SMART
K167R 1937 2047 1.6e-56 SMART
K167R 2058 2164 4.04e-53 SMART
K167R 2175 2285 1.52e-57 SMART
K167R 2296 2407 1.78e-40 SMART
K167R 2418 2527 1.71e-42 SMART
K167R 2538 2640 7.41e-20 SMART
K167R 2642 2750 1.06e-38 SMART
K167R 2761 2872 2.1e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211437
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.2%
  • 10x: 92.4%
  • 20x: 72.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that is associated with and may be necessary for cellular proliferation. Alternatively spliced transcript variants have been described. A related pseudogene exists on chromosome X. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice carrying a reporter allele show expression in actively dividing cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,846,002 (GRCm39) C811R possibly damaging Het
Akap8l G A 17: 32,557,416 (GRCm39) T65I possibly damaging Het
Arid4a T A 12: 71,069,034 (GRCm39) probably null Het
Armc2 C T 10: 41,842,696 (GRCm39) probably null Het
Atp6v1g1 A G 4: 63,468,258 (GRCm39) Y87C probably benign Het
Cfap54 A T 10: 92,757,281 (GRCm39) F273I possibly damaging Het
Clasrp C A 7: 19,319,165 (GRCm39) probably benign Het
Csmd2 T C 4: 128,451,511 (GRCm39) F113S unknown Het
Cyp4a14 C A 4: 115,344,498 (GRCm39) G456W probably damaging Het
Cyp4a30b A G 4: 115,315,559 (GRCm39) H260R possibly damaging Het
Ddrgk1 T A 2: 130,506,564 (GRCm39) probably benign Het
Dennd2b A T 7: 109,156,637 (GRCm39) Y38N probably benign Het
Dhx57 A T 17: 80,558,805 (GRCm39) D1051E probably benign Het
Eef2 GCCC GCCCC 10: 81,014,601 (GRCm39) probably null Het
Eif4enif1 C T 11: 3,192,586 (GRCm39) P805S probably damaging Het
Eml5 C T 12: 98,831,660 (GRCm39) D433N probably damaging Het
Fan1 A G 7: 64,012,938 (GRCm39) I668T probably benign Het
Frmpd4 A T X: 166,260,243 (GRCm39) D1166E probably benign Het
Ftdc1 A T 16: 58,434,342 (GRCm39) I125K probably benign Het
Gria2 G A 3: 80,609,799 (GRCm39) T670I probably damaging Het
Grid2ip C A 5: 143,343,684 (GRCm39) Q127K probably benign Het
Hdhd2 T C 18: 77,042,702 (GRCm39) F44L probably damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hmcn1 A T 1: 150,614,467 (GRCm39) V1313D possibly damaging Het
Ift172 C T 5: 31,415,205 (GRCm39) V1335I probably benign Het
Ighv2-2 G A 12: 113,552,118 (GRCm39) T40I possibly damaging Het
Kcnk10 T A 12: 98,401,072 (GRCm39) R520S probably benign Het
Kif1c A G 11: 70,614,907 (GRCm39) E567G probably damaging Het
Klf8 A T X: 152,165,678 (GRCm39) E82D probably damaging Het
Kpna7 T C 5: 144,930,745 (GRCm39) T367A probably benign Het
Lpo A G 11: 87,707,350 (GRCm39) I221T possibly damaging Het
Lrrn3 T C 12: 41,502,722 (GRCm39) I532V probably benign Het
Matr3 T A 18: 35,705,349 (GRCm39) S91R probably benign Het
Mlxip A G 5: 123,590,730 (GRCm39) M878V probably benign Het
Mpp7 G A 18: 7,461,678 (GRCm39) P65L possibly damaging Het
Mroh2a C A 1: 88,183,287 (GRCm39) L1292I probably damaging Het
Msh2 C A 17: 87,993,012 (GRCm39) Q314K possibly damaging Het
Mtor T A 4: 148,624,487 (GRCm39) M2089K probably benign Het
Myo9b G A 8: 71,786,981 (GRCm39) R721Q probably benign Het
Nlrp4b C T 7: 10,444,170 (GRCm39) Q40* probably null Het
Nomo1 C A 7: 45,696,361 (GRCm39) T293N probably damaging Het
Notum A G 11: 120,551,022 (GRCm39) V48A probably benign Het
Npas3 C T 12: 54,114,796 (GRCm39) R542* probably null Het
Or10z1 T C 1: 174,078,092 (GRCm39) S134G probably benign Het
Or13a17 A G 7: 140,271,198 (GRCm39) I127V possibly damaging Het
Or13j1 C A 4: 43,706,458 (GRCm39) V37L probably benign Het
Or5t16 A T 2: 86,819,192 (GRCm39) C109* probably null Het
Ostc T C 3: 130,497,157 (GRCm39) N80S probably damaging Het
Palmd T C 3: 116,717,400 (GRCm39) R366G possibly damaging Het
Parp1 A G 1: 180,401,230 (GRCm39) D45G probably damaging Het
Pcdhga9 T A 18: 37,870,524 (GRCm39) Y118N possibly damaging Het
Pes1 C A 11: 3,926,834 (GRCm39) T372K probably benign Het
Pkp4 C A 2: 59,138,500 (GRCm39) T250K probably benign Het
Plekhg5 T A 4: 152,191,960 (GRCm39) C433S probably benign Het
Plin2 A G 4: 86,586,915 (GRCm39) M1T probably null Het
Prdx4 A G X: 154,123,460 (GRCm39) V15A probably benign Het
Psmb8 T C 17: 34,419,144 (GRCm39) I146T probably damaging Het
Psmd13 A T 7: 140,466,968 (GRCm39) T116S probably damaging Het
Rel T C 11: 23,711,129 (GRCm39) I13V probably benign Het
Reln C T 5: 22,254,789 (GRCm39) V527I possibly damaging Het
Rnf6 T C 5: 146,147,215 (GRCm39) Y601C probably benign Het
Rps6kc1 T C 1: 190,631,766 (GRCm39) I48M probably damaging Het
Sfi1 CCTCTC CCTCTCTC 11: 3,127,419 (GRCm39) probably benign Het
Shoc1 A C 4: 59,093,850 (GRCm39) L226R probably damaging Het
Slc39a8 T A 3: 135,592,554 (GRCm39) probably null Het
Sppl2c C T 11: 104,078,141 (GRCm39) P314S probably benign Het
Tnni3k C T 3: 154,644,387 (GRCm39) probably null Het
Ugt1a1 AT A 1: 88,140,093 (GRCm39) probably null Het
Vmn2r68 A C 7: 84,882,834 (GRCm39) M306R probably benign Het
Vmn2r70 T A 7: 85,208,227 (GRCm39) Y750F probably damaging Het
Vwa7 G A 17: 35,240,218 (GRCm39) M395I probably damaging Het
Zfp53 A T 17: 21,728,340 (GRCm39) E124D probably benign Het
Other mutations in Mki67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Mki67 APN 7 135,291,849 (GRCm39) missense probably benign 0.32
IGL00264:Mki67 APN 7 135,309,549 (GRCm39) nonsense probably null
IGL00328:Mki67 APN 7 135,298,424 (GRCm39) missense probably benign 0.03
IGL00570:Mki67 APN 7 135,309,830 (GRCm39) missense possibly damaging 0.88
IGL00584:Mki67 APN 7 135,297,424 (GRCm39) missense probably damaging 1.00
IGL00756:Mki67 APN 7 135,300,460 (GRCm39) missense possibly damaging 0.76
IGL01063:Mki67 APN 7 135,296,651 (GRCm39) missense possibly damaging 0.93
IGL01112:Mki67 APN 7 135,315,745 (GRCm39) missense probably damaging 1.00
IGL01360:Mki67 APN 7 135,307,505 (GRCm39) missense probably damaging 1.00
IGL01457:Mki67 APN 7 135,301,275 (GRCm39) missense probably benign 0.00
IGL01686:Mki67 APN 7 135,309,542 (GRCm39) missense probably benign 0.00
IGL01731:Mki67 APN 7 135,298,278 (GRCm39) missense probably benign 0.03
IGL01775:Mki67 APN 7 135,300,005 (GRCm39) missense possibly damaging 0.71
IGL01806:Mki67 APN 7 135,300,686 (GRCm39) missense probably damaging 0.98
IGL01860:Mki67 APN 7 135,300,686 (GRCm39) missense probably damaging 0.98
IGL01938:Mki67 APN 7 135,296,059 (GRCm39) missense probably benign 0.04
IGL02249:Mki67 APN 7 135,302,251 (GRCm39) missense possibly damaging 0.47
IGL02260:Mki67 APN 7 135,303,697 (GRCm39) missense probably benign 0.00
IGL02270:Mki67 APN 7 135,300,361 (GRCm39) missense probably damaging 1.00
IGL02406:Mki67 APN 7 135,300,522 (GRCm39) missense probably benign 0.00
IGL02499:Mki67 APN 7 135,296,056 (GRCm39) missense possibly damaging 0.94
IGL02655:Mki67 APN 7 135,315,748 (GRCm39) missense probably damaging 0.98
IGL02700:Mki67 APN 7 135,309,931 (GRCm39) missense probably benign 0.02
IGL03370:Mki67 APN 7 135,297,219 (GRCm39) missense probably benign 0.00
Advisement UTSW 7 135,299,923 (GRCm39) missense probably damaging 1.00
chocotoff UTSW 7 135,300,628 (GRCm39) missense possibly damaging 0.92
Godiva UTSW 7 135,303,691 (GRCm39) missense probably benign 0.10
sees UTSW 7 135,302,644 (GRCm39) missense possibly damaging 0.68
Whitman UTSW 7 135,315,594 (GRCm39) missense probably damaging 1.00
BB003:Mki67 UTSW 7 135,298,869 (GRCm39) missense possibly damaging 0.91
BB013:Mki67 UTSW 7 135,298,869 (GRCm39) missense possibly damaging 0.91
PIT4468001:Mki67 UTSW 7 135,300,876 (GRCm39) missense probably benign 0.00
R0001:Mki67 UTSW 7 135,302,748 (GRCm39) missense probably damaging 0.99
R0001:Mki67 UTSW 7 135,300,901 (GRCm39) missense probably damaging 1.00
R0043:Mki67 UTSW 7 135,302,310 (GRCm39) missense probably benign 0.16
R0043:Mki67 UTSW 7 135,302,310 (GRCm39) missense probably benign 0.16
R0102:Mki67 UTSW 7 135,315,532 (GRCm39) missense probably benign 0.16
R0130:Mki67 UTSW 7 135,298,188 (GRCm39) missense probably damaging 1.00
R0149:Mki67 UTSW 7 135,300,153 (GRCm39) missense probably benign 0.00
R0356:Mki67 UTSW 7 135,306,135 (GRCm39) missense probably benign 0.34
R0482:Mki67 UTSW 7 135,301,158 (GRCm39) missense possibly damaging 0.60
R0508:Mki67 UTSW 7 135,302,075 (GRCm39) missense probably benign
R0532:Mki67 UTSW 7 135,299,893 (GRCm39) nonsense probably null
R0548:Mki67 UTSW 7 135,298,637 (GRCm39) missense possibly damaging 0.82
R0548:Mki67 UTSW 7 135,296,985 (GRCm39) missense probably damaging 1.00
R0557:Mki67 UTSW 7 135,300,990 (GRCm39) missense possibly damaging 0.48
R0627:Mki67 UTSW 7 135,309,987 (GRCm39) missense probably benign 0.31
R0631:Mki67 UTSW 7 135,306,117 (GRCm39) missense probably damaging 0.98
R0848:Mki67 UTSW 7 135,302,772 (GRCm39) missense probably benign 0.21
R1075:Mki67 UTSW 7 135,299,040 (GRCm39) missense probably benign 0.03
R1105:Mki67 UTSW 7 135,302,779 (GRCm39) missense probably benign 0.09
R1272:Mki67 UTSW 7 135,302,143 (GRCm39) nonsense probably null
R1331:Mki67 UTSW 7 135,300,005 (GRCm39) missense possibly damaging 0.71
R1486:Mki67 UTSW 7 135,301,449 (GRCm39) missense probably benign 0.00
R1510:Mki67 UTSW 7 135,297,900 (GRCm39) missense probably benign 0.26
R1573:Mki67 UTSW 7 135,296,845 (GRCm39) missense possibly damaging 0.93
R1586:Mki67 UTSW 7 135,315,701 (GRCm39) nonsense probably null
R1599:Mki67 UTSW 7 135,301,663 (GRCm39) missense probably benign 0.34
R1623:Mki67 UTSW 7 135,310,547 (GRCm39) splice site probably null
R1706:Mki67 UTSW 7 135,302,295 (GRCm39) missense probably benign 0.37
R1718:Mki67 UTSW 7 135,297,223 (GRCm39) missense probably damaging 1.00
R1785:Mki67 UTSW 7 135,305,970 (GRCm39) critical splice acceptor site probably null
R1816:Mki67 UTSW 7 135,309,116 (GRCm39) missense possibly damaging 0.68
R1862:Mki67 UTSW 7 135,301,090 (GRCm39) missense probably benign 0.09
R1929:Mki67 UTSW 7 135,299,794 (GRCm39) missense possibly damaging 0.46
R1957:Mki67 UTSW 7 135,300,128 (GRCm39) missense probably benign 0.01
R1971:Mki67 UTSW 7 135,315,688 (GRCm39) critical splice donor site probably null
R1998:Mki67 UTSW 7 135,307,499 (GRCm39) missense probably benign 0.00
R2004:Mki67 UTSW 7 135,300,238 (GRCm39) nonsense probably null
R2005:Mki67 UTSW 7 135,300,238 (GRCm39) nonsense probably null
R2006:Mki67 UTSW 7 135,300,238 (GRCm39) nonsense probably null
R2109:Mki67 UTSW 7 135,299,592 (GRCm39) missense probably damaging 1.00
R2130:Mki67 UTSW 7 135,305,970 (GRCm39) critical splice acceptor site probably null
R2131:Mki67 UTSW 7 135,305,970 (GRCm39) critical splice acceptor site probably null
R2133:Mki67 UTSW 7 135,305,970 (GRCm39) critical splice acceptor site probably null
R2140:Mki67 UTSW 7 135,297,321 (GRCm39) missense possibly damaging 0.94
R2141:Mki67 UTSW 7 135,297,321 (GRCm39) missense possibly damaging 0.94
R2142:Mki67 UTSW 7 135,297,321 (GRCm39) missense possibly damaging 0.94
R2284:Mki67 UTSW 7 135,301,674 (GRCm39) missense probably damaging 0.99
R2869:Mki67 UTSW 7 135,309,878 (GRCm39) missense probably benign 0.19
R2869:Mki67 UTSW 7 135,309,878 (GRCm39) missense probably benign 0.19
R2871:Mki67 UTSW 7 135,309,878 (GRCm39) missense probably benign 0.19
R2913:Mki67 UTSW 7 135,302,415 (GRCm39) missense possibly damaging 0.71
R3404:Mki67 UTSW 7 135,309,204 (GRCm39) missense probably benign 0.01
R3405:Mki67 UTSW 7 135,309,204 (GRCm39) missense probably benign 0.01
R3406:Mki67 UTSW 7 135,309,204 (GRCm39) missense probably benign 0.01
R3777:Mki67 UTSW 7 135,297,859 (GRCm39) missense probably benign 0.10
R3778:Mki67 UTSW 7 135,297,859 (GRCm39) missense probably benign 0.10
R3787:Mki67 UTSW 7 135,302,012 (GRCm39) missense possibly damaging 0.93
R3847:Mki67 UTSW 7 135,297,859 (GRCm39) missense probably benign 0.10
R3848:Mki67 UTSW 7 135,297,859 (GRCm39) missense probably benign 0.10
R3853:Mki67 UTSW 7 135,297,859 (GRCm39) missense probably benign 0.10
R3971:Mki67 UTSW 7 135,297,859 (GRCm39) missense probably benign 0.10
R3972:Mki67 UTSW 7 135,297,859 (GRCm39) missense probably benign 0.10
R4258:Mki67 UTSW 7 135,297,017 (GRCm39) missense possibly damaging 0.86
R4343:Mki67 UTSW 7 135,296,847 (GRCm39) missense probably benign 0.10
R4488:Mki67 UTSW 7 135,299,400 (GRCm39) missense probably benign 0.01
R4528:Mki67 UTSW 7 135,297,088 (GRCm39) missense probably damaging 1.00
R4713:Mki67 UTSW 7 135,297,198 (GRCm39) missense probably benign 0.35
R4867:Mki67 UTSW 7 135,301,585 (GRCm39) missense probably damaging 0.97
R4874:Mki67 UTSW 7 135,310,500 (GRCm39) missense probably damaging 0.97
R4897:Mki67 UTSW 7 135,298,474 (GRCm39) missense probably damaging 1.00
R5045:Mki67 UTSW 7 135,309,633 (GRCm39) missense possibly damaging 0.84
R5306:Mki67 UTSW 7 135,315,730 (GRCm39) missense probably damaging 1.00
R5309:Mki67 UTSW 7 135,302,559 (GRCm39) missense probably damaging 1.00
R5312:Mki67 UTSW 7 135,302,559 (GRCm39) missense probably damaging 1.00
R5379:Mki67 UTSW 7 135,299,190 (GRCm39) missense possibly damaging 0.95
R5506:Mki67 UTSW 7 135,301,710 (GRCm39) missense possibly damaging 0.60
R5513:Mki67 UTSW 7 135,309,479 (GRCm39) missense probably damaging 0.98
R5742:Mki67 UTSW 7 135,306,102 (GRCm39) missense probably benign 0.20
R5806:Mki67 UTSW 7 135,306,334 (GRCm39) missense probably damaging 1.00
R6008:Mki67 UTSW 7 135,299,158 (GRCm39) missense probably damaging 1.00
R6037:Mki67 UTSW 7 135,298,532 (GRCm39) missense possibly damaging 0.69
R6037:Mki67 UTSW 7 135,298,532 (GRCm39) missense possibly damaging 0.69
R6221:Mki67 UTSW 7 135,299,643 (GRCm39) missense probably benign 0.18
R6294:Mki67 UTSW 7 135,306,319 (GRCm39) missense probably benign 0.09
R6377:Mki67 UTSW 7 135,298,050 (GRCm39) missense possibly damaging 0.67
R6456:Mki67 UTSW 7 135,301,204 (GRCm39) missense possibly damaging 0.59
R6608:Mki67 UTSW 7 135,300,090 (GRCm39) missense probably benign 0.01
R6609:Mki67 UTSW 7 135,301,558 (GRCm39) missense possibly damaging 0.94
R6648:Mki67 UTSW 7 135,299,169 (GRCm39) missense probably damaging 1.00
R6901:Mki67 UTSW 7 135,310,489 (GRCm39) splice site probably null
R6978:Mki67 UTSW 7 135,303,691 (GRCm39) missense probably benign 0.10
R6985:Mki67 UTSW 7 135,315,594 (GRCm39) missense probably damaging 1.00
R7076:Mki67 UTSW 7 135,307,358 (GRCm39) missense probably damaging 0.98
R7217:Mki67 UTSW 7 135,305,911 (GRCm39) missense probably damaging 1.00
R7239:Mki67 UTSW 7 135,301,905 (GRCm39) missense possibly damaging 0.91
R7250:Mki67 UTSW 7 135,301,053 (GRCm39) missense possibly damaging 0.90
R7313:Mki67 UTSW 7 135,296,400 (GRCm39) missense probably benign 0.29
R7336:Mki67 UTSW 7 135,315,568 (GRCm39) missense probably benign 0.03
R7422:Mki67 UTSW 7 135,300,099 (GRCm39) missense probably damaging 1.00
R7451:Mki67 UTSW 7 135,301,080 (GRCm39) missense probably benign 0.01
R7502:Mki67 UTSW 7 135,302,512 (GRCm39) missense possibly damaging 0.53
R7513:Mki67 UTSW 7 135,294,952 (GRCm39) missense probably benign
R7578:Mki67 UTSW 7 135,302,644 (GRCm39) missense possibly damaging 0.68
R7619:Mki67 UTSW 7 135,301,106 (GRCm39) missense probably benign 0.01
R7646:Mki67 UTSW 7 135,298,498 (GRCm39) missense possibly damaging 0.63
R7659:Mki67 UTSW 7 135,299,155 (GRCm39) missense probably damaging 1.00
R7691:Mki67 UTSW 7 135,303,721 (GRCm39) missense not run
R7780:Mki67 UTSW 7 135,315,697 (GRCm39) missense probably benign 0.02
R7796:Mki67 UTSW 7 135,299,923 (GRCm39) missense probably damaging 1.00
R7904:Mki67 UTSW 7 135,294,816 (GRCm39) missense possibly damaging 0.90
R7911:Mki67 UTSW 7 135,306,333 (GRCm39) missense probably damaging 1.00
R7921:Mki67 UTSW 7 135,296,933 (GRCm39) missense probably benign 0.01
R7926:Mki67 UTSW 7 135,298,869 (GRCm39) missense possibly damaging 0.91
R7950:Mki67 UTSW 7 135,301,453 (GRCm39) nonsense probably null
R8130:Mki67 UTSW 7 135,299,293 (GRCm39) missense probably damaging 1.00
R8145:Mki67 UTSW 7 135,296,065 (GRCm39) missense probably benign 0.07
R8196:Mki67 UTSW 7 135,297,237 (GRCm39) missense probably damaging 1.00
R8220:Mki67 UTSW 7 135,299,850 (GRCm39) missense probably benign 0.03
R8299:Mki67 UTSW 7 135,306,349 (GRCm39) missense probably damaging 1.00
R8334:Mki67 UTSW 7 135,298,245 (GRCm39) missense probably damaging 0.98
R8350:Mki67 UTSW 7 135,300,200 (GRCm39) missense possibly damaging 0.82
R8358:Mki67 UTSW 7 135,301,855 (GRCm39) missense possibly damaging 0.46
R8529:Mki67 UTSW 7 135,315,688 (GRCm39) critical splice donor site probably null
R8698:Mki67 UTSW 7 135,296,937 (GRCm39) missense possibly damaging 0.87
R8700:Mki67 UTSW 7 135,307,436 (GRCm39) missense
R8737:Mki67 UTSW 7 135,315,504 (GRCm39) missense probably damaging 1.00
R8914:Mki67 UTSW 7 135,299,595 (GRCm39) missense
R8930:Mki67 UTSW 7 135,300,628 (GRCm39) missense possibly damaging 0.92
R8932:Mki67 UTSW 7 135,300,628 (GRCm39) missense possibly damaging 0.92
R8972:Mki67 UTSW 7 135,297,364 (GRCm39) missense possibly damaging 0.54
R8973:Mki67 UTSW 7 135,297,364 (GRCm39) missense possibly damaging 0.54
R8975:Mki67 UTSW 7 135,300,129 (GRCm39) missense probably benign 0.01
R8975:Mki67 UTSW 7 135,297,364 (GRCm39) missense possibly damaging 0.54
R9071:Mki67 UTSW 7 135,301,205 (GRCm39) missense probably benign 0.00
R9241:Mki67 UTSW 7 135,297,653 (GRCm39) missense possibly damaging 0.93
R9387:Mki67 UTSW 7 135,302,378 (GRCm39) missense probably damaging 0.99
R9524:Mki67 UTSW 7 135,305,913 (GRCm39) missense probably damaging 1.00
R9565:Mki67 UTSW 7 135,309,233 (GRCm39) frame shift probably null
R9782:Mki67 UTSW 7 135,306,066 (GRCm39) critical splice donor site probably null
X0020:Mki67 UTSW 7 135,315,730 (GRCm39) missense probably damaging 0.96
X0065:Mki67 UTSW 7 135,315,573 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACACCAATAGCTGTGTCTCCC -3'
(R):5'- TTGCCAAGATGGGGAAGGTC -3'

Sequencing Primer
(F):5'- GGGTTCTGATTTCCTACAAGATTTC -3'
(R):5'- GAAGGTCAAGATACCAAAGCTTC -3'
Posted On 2014-12-04