Incidental Mutation 'R2871:Or13a17'
ID 253734
Institutional Source Beutler Lab
Gene Symbol Or13a17
Ensembl Gene ENSMUSG00000066122
Gene Name olfactory receptor family 13 subfamily A member 17
Synonyms IB6, Olfr45, MOR253-2, GA_x6K02T2PBJ9-42837030-42837962
MMRRC Submission 040459-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.068) question?
Stock # R2871 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 140270797-140271832 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 140271198 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 127 (I127V)
Ref Sequence ENSEMBL: ENSMUSP00000149309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084454] [ENSMUST00000210241] [ENSMUST00000214637]
AlphaFold Q8VGM1
Predicted Effect possibly damaging
Transcript: ENSMUST00000084454
AA Change: I127V

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000081492
Gene: ENSMUSG00000066122
AA Change: I127V

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 2.8e-50 PFAM
Pfam:7TM_GPCR_Srsx 36 176 1.2e-7 PFAM
Pfam:7tm_1 42 291 3.7e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210241
AA Change: I127V
Predicted Effect possibly damaging
Transcript: ENSMUST00000214637
AA Change: I127V

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.2%
  • 10x: 92.4%
  • 20x: 72.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,846,002 (GRCm39) C811R possibly damaging Het
Akap8l G A 17: 32,557,416 (GRCm39) T65I possibly damaging Het
Arid4a T A 12: 71,069,034 (GRCm39) probably null Het
Armc2 C T 10: 41,842,696 (GRCm39) probably null Het
Atp6v1g1 A G 4: 63,468,258 (GRCm39) Y87C probably benign Het
Cfap54 A T 10: 92,757,281 (GRCm39) F273I possibly damaging Het
Clasrp C A 7: 19,319,165 (GRCm39) probably benign Het
Csmd2 T C 4: 128,451,511 (GRCm39) F113S unknown Het
Cyp4a14 C A 4: 115,344,498 (GRCm39) G456W probably damaging Het
Cyp4a30b A G 4: 115,315,559 (GRCm39) H260R possibly damaging Het
Ddrgk1 T A 2: 130,506,564 (GRCm39) probably benign Het
Dennd2b A T 7: 109,156,637 (GRCm39) Y38N probably benign Het
Dhx57 A T 17: 80,558,805 (GRCm39) D1051E probably benign Het
Eef2 GCCC GCCCC 10: 81,014,601 (GRCm39) probably null Het
Eif4enif1 C T 11: 3,192,586 (GRCm39) P805S probably damaging Het
Eml5 C T 12: 98,831,660 (GRCm39) D433N probably damaging Het
Fan1 A G 7: 64,012,938 (GRCm39) I668T probably benign Het
Frmpd4 A T X: 166,260,243 (GRCm39) D1166E probably benign Het
Ftdc1 A T 16: 58,434,342 (GRCm39) I125K probably benign Het
Gria2 G A 3: 80,609,799 (GRCm39) T670I probably damaging Het
Grid2ip C A 5: 143,343,684 (GRCm39) Q127K probably benign Het
Hdhd2 T C 18: 77,042,702 (GRCm39) F44L probably damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hmcn1 A T 1: 150,614,467 (GRCm39) V1313D possibly damaging Het
Ift172 C T 5: 31,415,205 (GRCm39) V1335I probably benign Het
Ighv2-2 G A 12: 113,552,118 (GRCm39) T40I possibly damaging Het
Kcnk10 T A 12: 98,401,072 (GRCm39) R520S probably benign Het
Kif1c A G 11: 70,614,907 (GRCm39) E567G probably damaging Het
Klf8 A T X: 152,165,678 (GRCm39) E82D probably damaging Het
Kpna7 T C 5: 144,930,745 (GRCm39) T367A probably benign Het
Lpo A G 11: 87,707,350 (GRCm39) I221T possibly damaging Het
Lrrn3 T C 12: 41,502,722 (GRCm39) I532V probably benign Het
Matr3 T A 18: 35,705,349 (GRCm39) S91R probably benign Het
Mki67 G A 7: 135,309,878 (GRCm39) P191L probably benign Het
Mlxip A G 5: 123,590,730 (GRCm39) M878V probably benign Het
Mpp7 G A 18: 7,461,678 (GRCm39) P65L possibly damaging Het
Mroh2a C A 1: 88,183,287 (GRCm39) L1292I probably damaging Het
Msh2 C A 17: 87,993,012 (GRCm39) Q314K possibly damaging Het
Mtor T A 4: 148,624,487 (GRCm39) M2089K probably benign Het
Myo9b G A 8: 71,786,981 (GRCm39) R721Q probably benign Het
Nlrp4b C T 7: 10,444,170 (GRCm39) Q40* probably null Het
Nomo1 C A 7: 45,696,361 (GRCm39) T293N probably damaging Het
Notum A G 11: 120,551,022 (GRCm39) V48A probably benign Het
Npas3 C T 12: 54,114,796 (GRCm39) R542* probably null Het
Or10z1 T C 1: 174,078,092 (GRCm39) S134G probably benign Het
Or13j1 C A 4: 43,706,458 (GRCm39) V37L probably benign Het
Or5t16 A T 2: 86,819,192 (GRCm39) C109* probably null Het
Ostc T C 3: 130,497,157 (GRCm39) N80S probably damaging Het
Palmd T C 3: 116,717,400 (GRCm39) R366G possibly damaging Het
Parp1 A G 1: 180,401,230 (GRCm39) D45G probably damaging Het
Pcdhga9 T A 18: 37,870,524 (GRCm39) Y118N possibly damaging Het
Pes1 C A 11: 3,926,834 (GRCm39) T372K probably benign Het
Pkp4 C A 2: 59,138,500 (GRCm39) T250K probably benign Het
Plekhg5 T A 4: 152,191,960 (GRCm39) C433S probably benign Het
Plin2 A G 4: 86,586,915 (GRCm39) M1T probably null Het
Prdx4 A G X: 154,123,460 (GRCm39) V15A probably benign Het
Psmb8 T C 17: 34,419,144 (GRCm39) I146T probably damaging Het
Psmd13 A T 7: 140,466,968 (GRCm39) T116S probably damaging Het
Rel T C 11: 23,711,129 (GRCm39) I13V probably benign Het
Reln C T 5: 22,254,789 (GRCm39) V527I possibly damaging Het
Rnf6 T C 5: 146,147,215 (GRCm39) Y601C probably benign Het
Rps6kc1 T C 1: 190,631,766 (GRCm39) I48M probably damaging Het
Sfi1 CCTCTC CCTCTCTC 11: 3,127,419 (GRCm39) probably benign Het
Shoc1 A C 4: 59,093,850 (GRCm39) L226R probably damaging Het
Slc39a8 T A 3: 135,592,554 (GRCm39) probably null Het
Sppl2c C T 11: 104,078,141 (GRCm39) P314S probably benign Het
Tnni3k C T 3: 154,644,387 (GRCm39) probably null Het
Ugt1a1 AT A 1: 88,140,093 (GRCm39) probably null Het
Vmn2r68 A C 7: 84,882,834 (GRCm39) M306R probably benign Het
Vmn2r70 T A 7: 85,208,227 (GRCm39) Y750F probably damaging Het
Vwa7 G A 17: 35,240,218 (GRCm39) M395I probably damaging Het
Zfp53 A T 17: 21,728,340 (GRCm39) E124D probably benign Het
Other mutations in Or13a17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Or13a17 APN 7 140,271,349 (GRCm39) missense probably damaging 1.00
IGL01434:Or13a17 APN 7 140,271,531 (GRCm39) missense probably damaging 1.00
IGL01697:Or13a17 APN 7 140,271,565 (GRCm39) missense possibly damaging 0.61
IGL02167:Or13a17 APN 7 140,271,664 (GRCm39) missense probably damaging 0.98
IGL02388:Or13a17 APN 7 140,271,024 (GRCm39) missense probably benign 0.00
IGL03054:Or13a17 UTSW 7 140,271,623 (GRCm39) missense probably benign 0.10
R0107:Or13a17 UTSW 7 140,271,258 (GRCm39) missense probably benign
R0403:Or13a17 UTSW 7 140,271,222 (GRCm39) missense possibly damaging 0.80
R1344:Or13a17 UTSW 7 140,271,712 (GRCm39) missense probably damaging 0.98
R1859:Or13a17 UTSW 7 140,271,571 (GRCm39) missense possibly damaging 0.80
R2871:Or13a17 UTSW 7 140,271,198 (GRCm39) missense possibly damaging 0.95
R3611:Or13a17 UTSW 7 140,271,013 (GRCm39) missense probably benign 0.01
R3915:Or13a17 UTSW 7 140,270,888 (GRCm39) missense probably benign
R4551:Or13a17 UTSW 7 140,271,655 (GRCm39) missense probably damaging 1.00
R4552:Or13a17 UTSW 7 140,271,655 (GRCm39) missense probably damaging 1.00
R4627:Or13a17 UTSW 7 140,271,291 (GRCm39) missense probably benign 0.00
R4628:Or13a17 UTSW 7 140,271,291 (GRCm39) missense probably benign 0.00
R4629:Or13a17 UTSW 7 140,271,291 (GRCm39) missense probably benign 0.00
R4990:Or13a17 UTSW 7 140,271,360 (GRCm39) missense probably damaging 0.99
R5503:Or13a17 UTSW 7 140,271,309 (GRCm39) missense probably benign 0.01
R7861:Or13a17 UTSW 7 140,271,484 (GRCm39) missense probably damaging 1.00
R8077:Or13a17 UTSW 7 140,271,046 (GRCm39) missense probably benign 0.16
R8268:Or13a17 UTSW 7 140,271,430 (GRCm39) missense probably damaging 1.00
R8532:Or13a17 UTSW 7 140,271,712 (GRCm39) missense probably damaging 0.98
R8978:Or13a17 UTSW 7 140,271,642 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CACGGATATTTTGTGCACCTCC -3'
(R):5'- GTAAGCACAAAATTGACGCCTC -3'

Sequencing Primer
(F):5'- CTCTGTGATTCCTAAGGCCTTGG -3'
(R):5'- GGAATCTCCCAAAAGAGTCATAATG -3'
Posted On 2014-12-04