Incidental Mutation 'R2871:Psmd13'
ID 253736
Institutional Source Beutler Lab
Gene Symbol Psmd13
Ensembl Gene ENSMUSG00000025487
Gene Name proteasome (prosome, macropain) 26S subunit, non-ATPase, 13
Synonyms 26S proteasome subunit p40.5, S11
MMRRC Submission 040459-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.965) question?
Stock # R2871 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 140462307-140478555 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 140466968 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 116 (T116S)
Ref Sequence ENSEMBL: ENSMUSP00000130580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026559] [ENSMUST00000026560] [ENSMUST00000163610] [ENSMUST00000164681] [ENSMUST00000211179] [ENSMUST00000210296] [ENSMUST00000166889]
AlphaFold Q9WVJ2
Predicted Effect probably benign
Transcript: ENSMUST00000026559
SMART Domains Protein: ENSMUSP00000026559
Gene: ENSMUSG00000025486

DomainStartEndE-ValueType
Pfam:SIR2 3 184 5.3e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026560
AA Change: T116S

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000026560
Gene: ENSMUSG00000025487
AA Change: T116S

DomainStartEndE-ValueType
low complexity region 9 14 N/A INTRINSIC
PINT 263 356 2.26e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121585
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125668
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129683
Predicted Effect probably benign
Transcript: ENSMUST00000130462
SMART Domains Protein: ENSMUSP00000126160
Gene: ENSMUSG00000025487

DomainStartEndE-ValueType
PINT 100 189 6.59e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140411
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151644
Predicted Effect probably damaging
Transcript: ENSMUST00000163610
AA Change: T116S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130580
Gene: ENSMUSG00000025487
AA Change: T116S

DomainStartEndE-ValueType
low complexity region 9 14 N/A INTRINSIC
PDB:4CR4|O 16 347 7e-44 PDB
Blast:PINT 245 329 9e-26 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000164681
AA Change: T116S

PolyPhen 2 Score 0.393 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000132405
Gene: ENSMUSG00000025487
AA Change: T116S

DomainStartEndE-ValueType
low complexity region 9 14 N/A INTRINSIC
PDB:4CR4|O 16 184 1e-12 PDB
low complexity region 217 232 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211179
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210398
Predicted Effect probably benign
Transcript: ENSMUST00000210296
Predicted Effect probably benign
Transcript: ENSMUST00000166889
SMART Domains Protein: ENSMUSP00000126532
Gene: ENSMUSG00000025487

DomainStartEndE-ValueType
low complexity region 9 14 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.2%
  • 10x: 92.4%
  • 20x: 72.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a non-ATPase subunit of the 19S regulator. Two transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,846,002 (GRCm39) C811R possibly damaging Het
Akap8l G A 17: 32,557,416 (GRCm39) T65I possibly damaging Het
Arid4a T A 12: 71,069,034 (GRCm39) probably null Het
Armc2 C T 10: 41,842,696 (GRCm39) probably null Het
Atp6v1g1 A G 4: 63,468,258 (GRCm39) Y87C probably benign Het
Cfap54 A T 10: 92,757,281 (GRCm39) F273I possibly damaging Het
Clasrp C A 7: 19,319,165 (GRCm39) probably benign Het
Csmd2 T C 4: 128,451,511 (GRCm39) F113S unknown Het
Cyp4a14 C A 4: 115,344,498 (GRCm39) G456W probably damaging Het
Cyp4a30b A G 4: 115,315,559 (GRCm39) H260R possibly damaging Het
Ddrgk1 T A 2: 130,506,564 (GRCm39) probably benign Het
Dennd2b A T 7: 109,156,637 (GRCm39) Y38N probably benign Het
Dhx57 A T 17: 80,558,805 (GRCm39) D1051E probably benign Het
Eef2 GCCC GCCCC 10: 81,014,601 (GRCm39) probably null Het
Eif4enif1 C T 11: 3,192,586 (GRCm39) P805S probably damaging Het
Eml5 C T 12: 98,831,660 (GRCm39) D433N probably damaging Het
Fan1 A G 7: 64,012,938 (GRCm39) I668T probably benign Het
Frmpd4 A T X: 166,260,243 (GRCm39) D1166E probably benign Het
Ftdc1 A T 16: 58,434,342 (GRCm39) I125K probably benign Het
Gria2 G A 3: 80,609,799 (GRCm39) T670I probably damaging Het
Grid2ip C A 5: 143,343,684 (GRCm39) Q127K probably benign Het
Hdhd2 T C 18: 77,042,702 (GRCm39) F44L probably damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hmcn1 A T 1: 150,614,467 (GRCm39) V1313D possibly damaging Het
Ift172 C T 5: 31,415,205 (GRCm39) V1335I probably benign Het
Ighv2-2 G A 12: 113,552,118 (GRCm39) T40I possibly damaging Het
Kcnk10 T A 12: 98,401,072 (GRCm39) R520S probably benign Het
Kif1c A G 11: 70,614,907 (GRCm39) E567G probably damaging Het
Klf8 A T X: 152,165,678 (GRCm39) E82D probably damaging Het
Kpna7 T C 5: 144,930,745 (GRCm39) T367A probably benign Het
Lpo A G 11: 87,707,350 (GRCm39) I221T possibly damaging Het
Lrrn3 T C 12: 41,502,722 (GRCm39) I532V probably benign Het
Matr3 T A 18: 35,705,349 (GRCm39) S91R probably benign Het
Mki67 G A 7: 135,309,878 (GRCm39) P191L probably benign Het
Mlxip A G 5: 123,590,730 (GRCm39) M878V probably benign Het
Mpp7 G A 18: 7,461,678 (GRCm39) P65L possibly damaging Het
Mroh2a C A 1: 88,183,287 (GRCm39) L1292I probably damaging Het
Msh2 C A 17: 87,993,012 (GRCm39) Q314K possibly damaging Het
Mtor T A 4: 148,624,487 (GRCm39) M2089K probably benign Het
Myo9b G A 8: 71,786,981 (GRCm39) R721Q probably benign Het
Nlrp4b C T 7: 10,444,170 (GRCm39) Q40* probably null Het
Nomo1 C A 7: 45,696,361 (GRCm39) T293N probably damaging Het
Notum A G 11: 120,551,022 (GRCm39) V48A probably benign Het
Npas3 C T 12: 54,114,796 (GRCm39) R542* probably null Het
Or10z1 T C 1: 174,078,092 (GRCm39) S134G probably benign Het
Or13a17 A G 7: 140,271,198 (GRCm39) I127V possibly damaging Het
Or13j1 C A 4: 43,706,458 (GRCm39) V37L probably benign Het
Or5t16 A T 2: 86,819,192 (GRCm39) C109* probably null Het
Ostc T C 3: 130,497,157 (GRCm39) N80S probably damaging Het
Palmd T C 3: 116,717,400 (GRCm39) R366G possibly damaging Het
Parp1 A G 1: 180,401,230 (GRCm39) D45G probably damaging Het
Pcdhga9 T A 18: 37,870,524 (GRCm39) Y118N possibly damaging Het
Pes1 C A 11: 3,926,834 (GRCm39) T372K probably benign Het
Pkp4 C A 2: 59,138,500 (GRCm39) T250K probably benign Het
Plekhg5 T A 4: 152,191,960 (GRCm39) C433S probably benign Het
Plin2 A G 4: 86,586,915 (GRCm39) M1T probably null Het
Prdx4 A G X: 154,123,460 (GRCm39) V15A probably benign Het
Psmb8 T C 17: 34,419,144 (GRCm39) I146T probably damaging Het
Rel T C 11: 23,711,129 (GRCm39) I13V probably benign Het
Reln C T 5: 22,254,789 (GRCm39) V527I possibly damaging Het
Rnf6 T C 5: 146,147,215 (GRCm39) Y601C probably benign Het
Rps6kc1 T C 1: 190,631,766 (GRCm39) I48M probably damaging Het
Sfi1 CCTCTC CCTCTCTC 11: 3,127,419 (GRCm39) probably benign Het
Shoc1 A C 4: 59,093,850 (GRCm39) L226R probably damaging Het
Slc39a8 T A 3: 135,592,554 (GRCm39) probably null Het
Sppl2c C T 11: 104,078,141 (GRCm39) P314S probably benign Het
Tnni3k C T 3: 154,644,387 (GRCm39) probably null Het
Ugt1a1 AT A 1: 88,140,093 (GRCm39) probably null Het
Vmn2r68 A C 7: 84,882,834 (GRCm39) M306R probably benign Het
Vmn2r70 T A 7: 85,208,227 (GRCm39) Y750F probably damaging Het
Vwa7 G A 17: 35,240,218 (GRCm39) M395I probably damaging Het
Zfp53 A T 17: 21,728,340 (GRCm39) E124D probably benign Het
Other mutations in Psmd13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Psmd13 APN 7 140,477,534 (GRCm39) missense probably damaging 0.97
IGL02265:Psmd13 APN 7 140,462,431 (GRCm39) missense probably damaging 1.00
R0326:Psmd13 UTSW 7 140,477,624 (GRCm39) missense probably damaging 1.00
R1163:Psmd13 UTSW 7 140,477,367 (GRCm39) missense probably damaging 0.97
R1667:Psmd13 UTSW 7 140,470,522 (GRCm39) missense probably damaging 1.00
R1721:Psmd13 UTSW 7 140,463,430 (GRCm39) missense probably damaging 1.00
R1867:Psmd13 UTSW 7 140,463,430 (GRCm39) missense probably damaging 1.00
R1993:Psmd13 UTSW 7 140,478,107 (GRCm39) missense probably damaging 1.00
R2070:Psmd13 UTSW 7 140,477,561 (GRCm39) missense probably damaging 0.99
R2844:Psmd13 UTSW 7 140,477,653 (GRCm39) intron probably benign
R2845:Psmd13 UTSW 7 140,477,653 (GRCm39) intron probably benign
R2846:Psmd13 UTSW 7 140,477,653 (GRCm39) intron probably benign
R2869:Psmd13 UTSW 7 140,466,968 (GRCm39) missense probably damaging 0.99
R2869:Psmd13 UTSW 7 140,466,968 (GRCm39) missense probably damaging 0.99
R2871:Psmd13 UTSW 7 140,466,968 (GRCm39) missense probably damaging 0.99
R4358:Psmd13 UTSW 7 140,469,418 (GRCm39) intron probably benign
R4973:Psmd13 UTSW 7 140,466,766 (GRCm39) nonsense probably null
R5197:Psmd13 UTSW 7 140,474,374 (GRCm39) splice site probably null
R6700:Psmd13 UTSW 7 140,470,522 (GRCm39) missense probably damaging 1.00
R8239:Psmd13 UTSW 7 140,466,450 (GRCm39) missense probably damaging 1.00
R8798:Psmd13 UTSW 7 140,477,663 (GRCm39) nonsense probably null
R9516:Psmd13 UTSW 7 140,478,455 (GRCm39) missense
Z1176:Psmd13 UTSW 7 140,462,339 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTTCTGGAAAAGACTCGTGAGAAG -3'
(R):5'- AAGTAACAGCGGGGACATCTC -3'

Sequencing Primer
(F):5'- GCATTTTCTAGTATTTACGTGATTCG -3'
(R):5'- CATCTCGGTTAGAATACGAGAGTGC -3'
Posted On 2014-12-04