Incidental Mutation 'R2516:Stom'
ID253741
Institutional Source Beutler Lab
Gene Symbol Stom
Ensembl Gene ENSMUSG00000026880
Gene Namestomatin
Synonymsstomatin, Epb7.2, protein 7.2b
MMRRC Submission 040420-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2516 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location35313986-35336976 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 35315965 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 251 (R251*)
Ref Sequence ENSEMBL: ENSMUSP00000028241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028241]
PDB Structure
SPFH domain of mouse stomatin (Crystal form 1) [X-RAY DIFFRACTION]
SPFH domain of mouse stomatin (Crystal form 3) [X-RAY DIFFRACTION]
SPFH domain of the mouse stomatin (Crystal form 2) [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000028241
AA Change: R251*
SMART Domains Protein: ENSMUSP00000028241
Gene: ENSMUSG00000026880
AA Change: R251*

DomainStartEndE-ValueType
PHB 52 211 1.11e-66 SMART
Blast:PHB 229 284 2e-27 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202568
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a highly conserved family of integral membrane proteins. The encoded protein localizes to the cell membrane of red blood cells and other cell types, where it may regulate ion channels and transporters. Loss of localization of the encoded protein is associated with hereditary stomatocytosis, a form of hemolytic anemia. There is a pseudogene for this gene on chromosome 6. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a targeted null mutation lack the protein but appear phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,329,329 I6N possibly damaging Het
Aen T C 7: 78,905,868 V188A probably damaging Het
Afg3l1 A G 8: 123,501,954 E753G probably damaging Het
Alas1 G A 9: 106,238,660 T385I probably damaging Het
Alms1 C A 6: 85,667,963 probably benign Het
Ankrd65 A G 4: 155,791,411 T30A possibly damaging Het
App T C 16: 84,978,229 S582G probably damaging Het
Arfgef1 A T 1: 10,153,654 V1473E possibly damaging Het
Arhgap21 G A 2: 20,854,998 P1196S probably damaging Het
Arhgap24 A G 5: 102,891,910 T238A probably benign Het
Atf7 T C 15: 102,529,004 probably benign Het
Best1 G T 19: 9,993,311 S55* probably null Het
Capn11 A G 17: 45,633,799 V514A probably damaging Het
Cep104 T A 4: 153,989,146 M52K probably damaging Het
Clca3a1 C T 3: 144,737,858 probably null Het
Cyp3a25 T C 5: 146,003,027 probably null Het
Dmxl2 G A 9: 54,400,094 P2197S probably damaging Het
Drosha T C 15: 12,859,465 probably null Het
Exosc9 A G 3: 36,563,162 K355R probably benign Het
Fut1 A C 7: 45,619,198 H192P probably benign Het
Gm572 T A 4: 148,664,384 V166D possibly damaging Het
Gm9966 C T 7: 95,958,528 P19S unknown Het
Gmds C T 13: 32,100,473 V219I probably damaging Het
Gsn G A 2: 35,283,953 E25K probably benign Het
Il4i1 T C 7: 44,839,891 F368S probably damaging Het
Irak1bp1 T C 9: 82,830,320 L98P probably damaging Het
Khdrbs3 T C 15: 69,024,695 probably benign Het
Kndc1 T C 7: 139,921,822 I925T probably damaging Het
Laptm4a T C 12: 8,938,151 I296T probably benign Het
Lpl A T 8: 68,887,518 H55L probably benign Het
Lrrk2 C A 15: 91,755,927 N1558K probably benign Het
Mfsd2a A G 4: 122,950,487 L289P probably damaging Het
Mmrn2 T A 14: 34,398,802 M543K probably benign Het
Mnat1 T C 12: 73,181,776 probably benign Het
Msto1 A T 3: 88,911,893 probably null Het
Mtus1 A G 8: 41,082,739 Y647H probably damaging Het
Nars A T 18: 64,505,016 V289E probably damaging Het
Oit3 T A 10: 59,428,345 K322N probably damaging Het
Oit3 G A 10: 59,441,685 probably benign Het
Olfr1024 A G 2: 85,904,556 I166T probably benign Het
Olfr1467 T A 19: 13,365,193 C188* probably null Het
Olfr728 T C 14: 50,139,983 I219V probably benign Het
Olfr801 G A 10: 129,670,286 R78W probably damaging Het
Pecr A T 1: 72,277,310 C79S probably damaging Het
Plekhn1 T C 4: 156,222,659 D478G probably damaging Het
Pls1 A T 9: 95,776,563 M264K probably benign Het
Ptprj C A 2: 90,474,996 probably benign Het
Pygm A G 19: 6,397,601 D646G probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scn8a T C 15: 100,969,162 V283A probably benign Het
Shisa5 T C 9: 109,056,507 probably null Het
Slc10a4 A G 5: 73,008,505 I246V possibly damaging Het
Slc1a1 A T 19: 28,892,912 I104F probably benign Het
Slc22a8 A G 19: 8,610,195 Y511C probably benign Het
Slc6a5 A G 7: 49,956,462 N706S probably benign Het
Sos2 T C 12: 69,650,659 K96E probably damaging Het
Sycp1 T C 3: 102,845,066 E800G probably benign Het
Tab2 G A 10: 7,907,481 P679L probably damaging Het
Tiam2 G A 17: 3,453,382 V945I probably damaging Het
Trpm5 G T 7: 143,074,517 P1007Q probably damaging Het
Uchl1 T G 5: 66,682,613 I139S probably damaging Het
Vmn1r232 A G 17: 20,914,026 I104T possibly damaging Het
Vmn2r97 G A 17: 18,947,552 M689I probably benign Het
Zc3h18 A T 8: 122,403,165 probably benign Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp456 T C 13: 67,362,372 K99R probably benign Het
Other mutations in Stom
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Stom APN 2 35336877 missense probably benign
IGL02103:Stom APN 2 35320389 missense probably benign 0.23
IGL02825:Stom APN 2 35321632 missense probably damaging 1.00
IGL03078:Stom APN 2 35315929 missense probably damaging 1.00
R0320:Stom UTSW 2 35321634 missense probably damaging 1.00
R0355:Stom UTSW 2 35325359 missense probably benign 0.22
R0417:Stom UTSW 2 35321632 missense probably damaging 1.00
R1711:Stom UTSW 2 35315917 missense probably damaging 1.00
R2059:Stom UTSW 2 35316025 missense probably damaging 1.00
R2219:Stom UTSW 2 35321601 missense possibly damaging 0.95
R2509:Stom UTSW 2 35320342 missense probably damaging 1.00
R4469:Stom UTSW 2 35321533 missense possibly damaging 0.95
R4592:Stom UTSW 2 35323746 missense probably damaging 1.00
R5240:Stom UTSW 2 35336877 missense probably benign
R7338:Stom UTSW 2 35323748 critical splice acceptor site probably null
R7532:Stom UTSW 2 35321577 missense possibly damaging 0.91
R7652:Stom UTSW 2 35316029 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AAGGCTAACTTTGTCCCCAC -3'
(R):5'- GTTTCAGGAAGAAGAGCCCC -3'

Sequencing Primer
(F):5'- CACTTTACCCTGGGAAGGATTCAG -3'
(R):5'- CCCCTGGGATCTGAGTGTCTAG -3'
Posted On2014-12-04