Incidental Mutation 'R2871:Eef2'
ID 253742
Institutional Source Beutler Lab
Gene Symbol Eef2
Ensembl Gene ENSMUSG00000034994
Gene Name eukaryotic translation elongation factor 2
Synonyms Ef-2
MMRRC Submission 040459-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.968) question?
Stock # R2871 (G1)
Quality Score 149
Status Not validated
Chromosome 10
Chromosomal Location 81012465-81018332 bp(+) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) GCCC to GCCCC at 81014601 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000046101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047665] [ENSMUST00000047864] [ENSMUST00000056086] [ENSMUST00000178422] [ENSMUST00000218157] [ENSMUST00000219133]
AlphaFold P58252
Predicted Effect probably benign
Transcript: ENSMUST00000047665
SMART Domains Protein: ENSMUSP00000035962
Gene: ENSMUSG00000034974

DomainStartEndE-ValueType
S_TKc 13 275 1.93e-98 SMART
low complexity region 288 299 N/A INTRINSIC
low complexity region 331 347 N/A INTRINSIC
low complexity region 349 411 N/A INTRINSIC
coiled coil region 419 444 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000047864
SMART Domains Protein: ENSMUSP00000046101
Gene: ENSMUSG00000034994

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 360 2e-65 PFAM
Pfam:MMR_HSR1 21 159 6.3e-6 PFAM
Pfam:GTP_EFTU_D2 409 486 2.3e-14 PFAM
Pfam:EFG_II 501 568 1.9e-14 PFAM
EFG_IV 621 737 5.56e-27 SMART
EFG_C 739 828 4.06e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000056086
SMART Domains Protein: ENSMUSP00000049685
Gene: ENSMUSG00000053603

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082507
Predicted Effect probably benign
Transcript: ENSMUST00000178422
SMART Domains Protein: ENSMUSP00000137333
Gene: ENSMUSG00000034974

DomainStartEndE-ValueType
S_TKc 13 275 1.93e-98 SMART
low complexity region 288 299 N/A INTRINSIC
low complexity region 331 347 N/A INTRINSIC
low complexity region 349 411 N/A INTRINSIC
coiled coil region 419 444 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217936
Predicted Effect probably benign
Transcript: ENSMUST00000218157
Predicted Effect probably benign
Transcript: ENSMUST00000219133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219329
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220076
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219943
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.2%
  • 10x: 92.4%
  • 20x: 72.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GTP-binding translation elongation factor family. This protein is an essential factor for protein synthesis. It promotes the GTP-dependent translocation of the nascent protein chain from the A-site to the P-site of the ribosome. This protein is completely inactivated by EF-2 kinase phosporylation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a mutation removing the diphthamide modification display partial neonatal lethality, fetal growth retardation and abnormal cell physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,846,002 (GRCm39) C811R possibly damaging Het
Akap8l G A 17: 32,557,416 (GRCm39) T65I possibly damaging Het
Arid4a T A 12: 71,069,034 (GRCm39) probably null Het
Armc2 C T 10: 41,842,696 (GRCm39) probably null Het
Atp6v1g1 A G 4: 63,468,258 (GRCm39) Y87C probably benign Het
Cfap54 A T 10: 92,757,281 (GRCm39) F273I possibly damaging Het
Clasrp C A 7: 19,319,165 (GRCm39) probably benign Het
Csmd2 T C 4: 128,451,511 (GRCm39) F113S unknown Het
Cyp4a14 C A 4: 115,344,498 (GRCm39) G456W probably damaging Het
Cyp4a30b A G 4: 115,315,559 (GRCm39) H260R possibly damaging Het
Ddrgk1 T A 2: 130,506,564 (GRCm39) probably benign Het
Dennd2b A T 7: 109,156,637 (GRCm39) Y38N probably benign Het
Dhx57 A T 17: 80,558,805 (GRCm39) D1051E probably benign Het
Eif4enif1 C T 11: 3,192,586 (GRCm39) P805S probably damaging Het
Eml5 C T 12: 98,831,660 (GRCm39) D433N probably damaging Het
Fan1 A G 7: 64,012,938 (GRCm39) I668T probably benign Het
Frmpd4 A T X: 166,260,243 (GRCm39) D1166E probably benign Het
Ftdc1 A T 16: 58,434,342 (GRCm39) I125K probably benign Het
Gria2 G A 3: 80,609,799 (GRCm39) T670I probably damaging Het
Grid2ip C A 5: 143,343,684 (GRCm39) Q127K probably benign Het
Hdhd2 T C 18: 77,042,702 (GRCm39) F44L probably damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hmcn1 A T 1: 150,614,467 (GRCm39) V1313D possibly damaging Het
Ift172 C T 5: 31,415,205 (GRCm39) V1335I probably benign Het
Ighv2-2 G A 12: 113,552,118 (GRCm39) T40I possibly damaging Het
Kcnk10 T A 12: 98,401,072 (GRCm39) R520S probably benign Het
Kif1c A G 11: 70,614,907 (GRCm39) E567G probably damaging Het
Klf8 A T X: 152,165,678 (GRCm39) E82D probably damaging Het
Kpna7 T C 5: 144,930,745 (GRCm39) T367A probably benign Het
Lpo A G 11: 87,707,350 (GRCm39) I221T possibly damaging Het
Lrrn3 T C 12: 41,502,722 (GRCm39) I532V probably benign Het
Matr3 T A 18: 35,705,349 (GRCm39) S91R probably benign Het
Mki67 G A 7: 135,309,878 (GRCm39) P191L probably benign Het
Mlxip A G 5: 123,590,730 (GRCm39) M878V probably benign Het
Mpp7 G A 18: 7,461,678 (GRCm39) P65L possibly damaging Het
Mroh2a C A 1: 88,183,287 (GRCm39) L1292I probably damaging Het
Msh2 C A 17: 87,993,012 (GRCm39) Q314K possibly damaging Het
Mtor T A 4: 148,624,487 (GRCm39) M2089K probably benign Het
Myo9b G A 8: 71,786,981 (GRCm39) R721Q probably benign Het
Nlrp4b C T 7: 10,444,170 (GRCm39) Q40* probably null Het
Nomo1 C A 7: 45,696,361 (GRCm39) T293N probably damaging Het
Notum A G 11: 120,551,022 (GRCm39) V48A probably benign Het
Npas3 C T 12: 54,114,796 (GRCm39) R542* probably null Het
Or10z1 T C 1: 174,078,092 (GRCm39) S134G probably benign Het
Or13a17 A G 7: 140,271,198 (GRCm39) I127V possibly damaging Het
Or13j1 C A 4: 43,706,458 (GRCm39) V37L probably benign Het
Or5t16 A T 2: 86,819,192 (GRCm39) C109* probably null Het
Ostc T C 3: 130,497,157 (GRCm39) N80S probably damaging Het
Palmd T C 3: 116,717,400 (GRCm39) R366G possibly damaging Het
Parp1 A G 1: 180,401,230 (GRCm39) D45G probably damaging Het
Pcdhga9 T A 18: 37,870,524 (GRCm39) Y118N possibly damaging Het
Pes1 C A 11: 3,926,834 (GRCm39) T372K probably benign Het
Pkp4 C A 2: 59,138,500 (GRCm39) T250K probably benign Het
Plekhg5 T A 4: 152,191,960 (GRCm39) C433S probably benign Het
Plin2 A G 4: 86,586,915 (GRCm39) M1T probably null Het
Prdx4 A G X: 154,123,460 (GRCm39) V15A probably benign Het
Psmb8 T C 17: 34,419,144 (GRCm39) I146T probably damaging Het
Psmd13 A T 7: 140,466,968 (GRCm39) T116S probably damaging Het
Rel T C 11: 23,711,129 (GRCm39) I13V probably benign Het
Reln C T 5: 22,254,789 (GRCm39) V527I possibly damaging Het
Rnf6 T C 5: 146,147,215 (GRCm39) Y601C probably benign Het
Rps6kc1 T C 1: 190,631,766 (GRCm39) I48M probably damaging Het
Sfi1 CCTCTC CCTCTCTC 11: 3,127,419 (GRCm39) probably benign Het
Shoc1 A C 4: 59,093,850 (GRCm39) L226R probably damaging Het
Slc39a8 T A 3: 135,592,554 (GRCm39) probably null Het
Sppl2c C T 11: 104,078,141 (GRCm39) P314S probably benign Het
Tnni3k C T 3: 154,644,387 (GRCm39) probably null Het
Ugt1a1 AT A 1: 88,140,093 (GRCm39) probably null Het
Vmn2r68 A C 7: 84,882,834 (GRCm39) M306R probably benign Het
Vmn2r70 T A 7: 85,208,227 (GRCm39) Y750F probably damaging Het
Vwa7 G A 17: 35,240,218 (GRCm39) M395I probably damaging Het
Zfp53 A T 17: 21,728,340 (GRCm39) E124D probably benign Het
Other mutations in Eef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Eef2 APN 10 81,017,816 (GRCm39) splice site probably null
IGL01303:Eef2 APN 10 81,017,777 (GRCm39) missense possibly damaging 0.93
IGL01376:Eef2 APN 10 81,013,883 (GRCm39) unclassified probably benign
IGL01876:Eef2 APN 10 81,016,104 (GRCm39) missense probably benign
IGL02000:Eef2 APN 10 81,015,845 (GRCm39) missense probably benign 0.13
IGL02514:Eef2 APN 10 81,015,427 (GRCm39) missense probably benign 0.11
IGL03087:Eef2 APN 10 81,017,081 (GRCm39) missense probably benign 0.12
IGL03389:Eef2 APN 10 81,015,540 (GRCm39) missense probably benign 0.40
fig UTSW 10 81,016,126 (GRCm39) missense possibly damaging 0.50
R0052:Eef2 UTSW 10 81,014,602 (GRCm39) frame shift probably null
R0178:Eef2 UTSW 10 81,016,126 (GRCm39) missense possibly damaging 0.50
R0445:Eef2 UTSW 10 81,014,604 (GRCm39) frame shift probably null
R0497:Eef2 UTSW 10 81,017,420 (GRCm39) missense probably benign 0.00
R0539:Eef2 UTSW 10 81,014,602 (GRCm39) frame shift probably null
R0745:Eef2 UTSW 10 81,017,830 (GRCm39) missense probably benign 0.00
R0811:Eef2 UTSW 10 81,014,603 (GRCm39) frame shift probably null
R0812:Eef2 UTSW 10 81,014,603 (GRCm39) frame shift probably null
R0832:Eef2 UTSW 10 81,014,603 (GRCm39) frame shift probably null
R1136:Eef2 UTSW 10 81,014,603 (GRCm39) frame shift probably null
R1298:Eef2 UTSW 10 81,014,602 (GRCm39) frame shift probably null
R1549:Eef2 UTSW 10 81,014,602 (GRCm39) frame shift probably null
R1550:Eef2 UTSW 10 81,016,681 (GRCm39) missense probably benign 0.04
R2869:Eef2 UTSW 10 81,014,601 (GRCm39) frame shift probably null
R2870:Eef2 UTSW 10 81,014,601 (GRCm39) frame shift probably null
R2872:Eef2 UTSW 10 81,014,601 (GRCm39) frame shift probably null
R3408:Eef2 UTSW 10 81,014,601 (GRCm39) frame shift probably null
R3414:Eef2 UTSW 10 81,013,692 (GRCm39) missense probably damaging 0.98
R4291:Eef2 UTSW 10 81,015,414 (GRCm39) missense probably benign 0.00
R4357:Eef2 UTSW 10 81,014,601 (GRCm39) frame shift probably null
R4433:Eef2 UTSW 10 81,014,602 (GRCm39) frame shift probably null
R4577:Eef2 UTSW 10 81,014,601 (GRCm39) frame shift probably null
R5154:Eef2 UTSW 10 81,014,601 (GRCm39) frame shift probably null
R5609:Eef2 UTSW 10 81,014,603 (GRCm39) frame shift probably null
R6545:Eef2 UTSW 10 81,016,948 (GRCm39) missense probably damaging 1.00
R6649:Eef2 UTSW 10 81,014,602 (GRCm39) frame shift probably null
R6650:Eef2 UTSW 10 81,014,602 (GRCm39) frame shift probably null
R7326:Eef2 UTSW 10 81,017,116 (GRCm39) missense probably benign 0.26
R7472:Eef2 UTSW 10 81,015,384 (GRCm39) missense probably benign 0.01
R7579:Eef2 UTSW 10 81,014,602 (GRCm39) frame shift probably null
R8013:Eef2 UTSW 10 81,014,030 (GRCm39) missense probably damaging 1.00
R8143:Eef2 UTSW 10 81,017,182 (GRCm39) missense probably damaging 1.00
R8783:Eef2 UTSW 10 81,015,499 (GRCm39) missense probably damaging 1.00
R8949:Eef2 UTSW 10 81,014,518 (GRCm39) missense probably damaging 1.00
R9017:Eef2 UTSW 10 81,015,487 (GRCm39) missense possibly damaging 0.66
R9115:Eef2 UTSW 10 81,014,603 (GRCm39) frame shift probably null
R9158:Eef2 UTSW 10 81,014,693 (GRCm39) unclassified probably benign
R9233:Eef2 UTSW 10 81,014,668 (GRCm39) missense probably benign 0.26
R9435:Eef2 UTSW 10 81,014,994 (GRCm39) missense probably benign 0.07
R9765:Eef2 UTSW 10 81,015,010 (GRCm39) missense possibly damaging 0.84
Z1088:Eef2 UTSW 10 81,017,723 (GRCm39) missense probably damaging 1.00
Z1176:Eef2 UTSW 10 81,016,992 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACCTTGGAGAGTGCTTGTGTAC -3'
(R):5'- ATGGTGGGTCAGAGATTCCC -3'

Sequencing Primer
(F):5'- CAAAACATACGTGGTCTTCAGG -3'
(R):5'- TCAGAGATTCCCAGGGAGC -3'
Posted On 2014-12-04