Mutagenetix > Incidental Mutation

Incidental Mutation 'R2516:Rif1'

253743

Institutional Source

Beutler Lab

Gene Symbol

Rif1

Ensembl Gene

ENSMUSG00000036202

Gene Name

replication timing regulatory factor 1

Synonyms

6530403D07Rik, 5730435J01Rik, D2Ertd145e

MMRRC Submission

040420-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2516 (G1)

Quality Score

217

Status

Validated

Chromosome

Chromosomal Location

52072832-52122383 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

GCCACCA to GCCA at 52110324 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069794] [ENSMUST00000112693]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000069794
AA Change: 1264

SMART Domains

Protein: ENSMUSP00000064155
Gene: ENSMUSG00000036202
AA Change: 1264

Domain	Start	End	E-Value	Type
Pfam:Rif1_N	22	368	3.3e-78	PFAM
low complexity region	432	444	N/A	INTRINSIC
low complexity region	586	598	N/A	INTRINSIC
low complexity region	1018	1038	N/A	INTRINSIC
low complexity region	1180	1205	N/A	INTRINSIC
low complexity region	1310	1321	N/A	INTRINSIC
low complexity region	1423	1446	N/A	INTRINSIC
low complexity region	1576	1586	N/A	INTRINSIC
low complexity region	1677	1690	N/A	INTRINSIC
low complexity region	1702	1712	N/A	INTRINSIC
low complexity region	2176	2195	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112693
AA Change: P1264

SMART Domains

Protein: ENSMUSP00000108313
Gene: ENSMUSG00000036202
AA Change: P1264

Domain	Start	End	E-Value	Type
Pfam:Rif1_N	18	381	1.4e-85	PFAM
low complexity region	432	444	N/A	INTRINSIC
low complexity region	586	598	N/A	INTRINSIC
low complexity region	1018	1038	N/A	INTRINSIC
low complexity region	1180	1205	N/A	INTRINSIC
low complexity region	1310	1321	N/A	INTRINSIC
low complexity region	1423	1446	N/A	INTRINSIC
low complexity region	1576	1586	N/A	INTRINSIC
low complexity region	1677	1690	N/A	INTRINSIC
low complexity region	1702	1712	N/A	INTRINSIC
low complexity region	2176	2195	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000125322

Predicted Effect

probably benign
Transcript: ENSMUST00000125376

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145130

Predicted Effect

probably benign
Transcript: ENSMUST00000152178

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

98% (65/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that shares homology with the yeast teleomere binding protein, Rap1 interacting factor 1. This protein localizes to aberrant telomeres may be involved in DNA repair. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice homozygous for a gene trap allele exhibit embryonic and postnatal lethality, reduced fertility, and decreased cell proliferation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	A	T	2: 69,329,329	I6N	possibly damaging	Het
Aen	T	C	7: 78,905,868	V188A	probably damaging	Het
Afg3l1	A	G	8: 123,501,954	E753G	probably damaging	Het
Alas1	G	A	9: 106,238,660	T385I	probably damaging	Het
Alms1	C	A	6: 85,667,963		probably benign	Het
Ankrd65	A	G	4: 155,791,411	T30A	possibly damaging	Het
App	T	C	16: 84,978,229	S582G	probably damaging	Het
Arfgef1	A	T	1: 10,153,654	V1473E	possibly damaging	Het
Arhgap21	G	A	2: 20,854,998	P1196S	probably damaging	Het
Arhgap24	A	G	5: 102,891,910	T238A	probably benign	Het
Atf7	T	C	15: 102,529,004		probably benign	Het
Best1	G	T	19: 9,993,311	S55*	probably null	Het
Capn11	A	G	17: 45,633,799	V514A	probably damaging	Het
Cep104	T	A	4: 153,989,146	M52K	probably damaging	Het
Clca3a1	C	T	3: 144,737,858		probably null	Het
Cyp3a25	T	C	5: 146,003,027		probably null	Het
Dmxl2	G	A	9: 54,400,094	P2197S	probably damaging	Het
Drosha	T	C	15: 12,859,465		probably null	Het
Exosc9	A	G	3: 36,563,162	K355R	probably benign	Het
Fut1	A	C	7: 45,619,198	H192P	probably benign	Het
Gm572	T	A	4: 148,664,384	V166D	possibly damaging	Het
Gm9966	C	T	7: 95,958,528	P19S	unknown	Het
Gmds	C	T	13: 32,100,473	V219I	probably damaging	Het
Gsn	G	A	2: 35,283,953	E25K	probably benign	Het
Il4i1	T	C	7: 44,839,891	F368S	probably damaging	Het
Irak1bp1	T	C	9: 82,830,320	L98P	probably damaging	Het
Khdrbs3	T	C	15: 69,024,695		probably benign	Het
Kndc1	T	C	7: 139,921,822	I925T	probably damaging	Het
Laptm4a	T	C	12: 8,938,151	I296T	probably benign	Het
Lpl	A	T	8: 68,887,518	H55L	probably benign	Het
Lrrk2	C	A	15: 91,755,927	N1558K	probably benign	Het
Mfsd2a	A	G	4: 122,950,487	L289P	probably damaging	Het
Mmrn2	T	A	14: 34,398,802	M543K	probably benign	Het
Mnat1	T	C	12: 73,181,776		probably benign	Het
Msto1	A	T	3: 88,911,893		probably null	Het
Mtus1	A	G	8: 41,082,739	Y647H	probably damaging	Het
Nars	A	T	18: 64,505,016	V289E	probably damaging	Het
Oit3	T	A	10: 59,428,345	K322N	probably damaging	Het
Oit3	G	A	10: 59,441,685		probably benign	Het
Olfr1024	A	G	2: 85,904,556	I166T	probably benign	Het
Olfr1467	T	A	19: 13,365,193	C188*	probably null	Het
Olfr728	T	C	14: 50,139,983	I219V	probably benign	Het
Olfr801	G	A	10: 129,670,286	R78W	probably damaging	Het
Pecr	A	T	1: 72,277,310	C79S	probably damaging	Het
Plekhn1	T	C	4: 156,222,659	D478G	probably damaging	Het
Pls1	A	T	9: 95,776,563	M264K	probably benign	Het
Ptprj	C	A	2: 90,474,996		probably benign	Het
Pygm	A	G	19: 6,397,601	D646G	probably benign	Het
Scn8a	T	C	15: 100,969,162	V283A	probably benign	Het
Shisa5	T	C	9: 109,056,507		probably null	Het
Slc10a4	A	G	5: 73,008,505	I246V	possibly damaging	Het
Slc1a1	A	T	19: 28,892,912	I104F	probably benign	Het
Slc22a8	A	G	19: 8,610,195	Y511C	probably benign	Het
Slc6a5	A	G	7: 49,956,462	N706S	probably benign	Het
Sos2	T	C	12: 69,650,659	K96E	probably damaging	Het
Stom	G	A	2: 35,315,965	R251*	probably null	Het
Sycp1	T	C	3: 102,845,066	E800G	probably benign	Het
Tab2	G	A	10: 7,907,481	P679L	probably damaging	Het
Tiam2	G	A	17: 3,453,382	V945I	probably damaging	Het
Trpm5	G	T	7: 143,074,517	P1007Q	probably damaging	Het
Uchl1	T	G	5: 66,682,613	I139S	probably damaging	Het
Vmn1r232	A	G	17: 20,914,026	I104T	possibly damaging	Het
Vmn2r97	G	A	17: 18,947,552	M689I	probably benign	Het
Zc3h18	A	T	8: 122,403,165		probably benign	Het
Zfhx4	C	T	3: 5,403,358	P2859S	probably benign	Het
Zfp456	T	C	13: 67,362,372	K99R	probably benign	Het

Other mutations in Rif1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Rif1	APN	2	52121007	missense	probably damaging	0.96
IGL00711:Rif1	APN	2	52111070	missense	probably benign	0.00
IGL00721:Rif1	APN	2	52119117	missense	probably damaging	1.00
IGL01085:Rif1	APN	2	52085140	missense	possibly damaging	0.71
IGL01093:Rif1	APN	2	52095948	missense	probably damaging	1.00
IGL01107:Rif1	APN	2	52111303	missense	probably benign	0.00
IGL01138:Rif1	APN	2	52111522	missense	probably damaging	1.00
IGL01844:Rif1	APN	2	52112543	missense	probably benign	0.07
IGL02441:Rif1	APN	2	52105515	missense	probably benign	0.00
IGL02448:Rif1	APN	2	52116696	missense	probably damaging	0.99
IGL02563:Rif1	APN	2	52077065	missense	probably damaging	1.00
IGL02704:Rif1	APN	2	52093576	missense	probably damaging	1.00
IGL02946:Rif1	APN	2	52110125	nonsense	probably null
IGL03060:Rif1	APN	2	52112137	missense	probably damaging	0.97
IGL03206:Rif1	APN	2	52103622	missense	probably damaging	1.00
IGL03263:Rif1	APN	2	52090261	missense	probably damaging	0.99
IGL03267:Rif1	APN	2	52076988	missense	possibly damaging	0.94
IGL03280:Rif1	APN	2	52112599	missense	probably benign	0.32
hifi	UTSW	2	52110324	unclassified	probably benign
nietzsche	UTSW	2	52077020	missense	probably benign	0.08
PIT4305001:Rif1	UTSW	2	52111958	missense
R0017:Rif1	UTSW	2	52116674	missense	probably benign	0.18
R0017:Rif1	UTSW	2	52116674	missense	probably benign	0.18
R0060:Rif1	UTSW	2	52111117	missense	probably damaging	1.00
R0060:Rif1	UTSW	2	52111117	missense	probably damaging	1.00
R0104:Rif1	UTSW	2	52110092	missense	possibly damaging	0.77
R0268:Rif1	UTSW	2	52090286	critical splice donor site	probably null
R0276:Rif1	UTSW	2	52110324	unclassified	probably benign
R0278:Rif1	UTSW	2	52110324	unclassified	probably benign
R0288:Rif1	UTSW	2	52110013	missense	probably damaging	1.00
R0314:Rif1	UTSW	2	52110324	unclassified	probably benign
R0345:Rif1	UTSW	2	52110324	unclassified	probably benign
R0346:Rif1	UTSW	2	52110324	unclassified	probably benign
R0383:Rif1	UTSW	2	52085141	missense	probably damaging	0.96
R0384:Rif1	UTSW	2	52110324	unclassified	probably benign
R0387:Rif1	UTSW	2	52110324	unclassified	probably benign
R0388:Rif1	UTSW	2	52110324	unclassified	probably benign
R0456:Rif1	UTSW	2	52110324	unclassified	probably benign
R0477:Rif1	UTSW	2	52110324	unclassified	probably benign
R0505:Rif1	UTSW	2	52110737	missense	probably damaging	0.99
R0510:Rif1	UTSW	2	52110324	unclassified	probably benign
R0511:Rif1	UTSW	2	52110324	unclassified	probably benign
R0512:Rif1	UTSW	2	52110324	unclassified	probably benign
R0633:Rif1	UTSW	2	52112563	missense	probably benign	0.00
R0637:Rif1	UTSW	2	52110324	unclassified	probably benign
R0638:Rif1	UTSW	2	52111588	missense	probably benign	0.12
R0666:Rif1	UTSW	2	52110324	unclassified	probably benign
R0675:Rif1	UTSW	2	52110324	unclassified	probably benign
R0707:Rif1	UTSW	2	52110324	unclassified	probably benign
R0726:Rif1	UTSW	2	52110353	missense	possibly damaging	0.52
R0743:Rif1	UTSW	2	52110324	unclassified	probably benign
R0744:Rif1	UTSW	2	52110324	unclassified	probably benign
R0938:Rif1	UTSW	2	52110324	unclassified	probably benign
R0939:Rif1	UTSW	2	52110324	unclassified	probably benign
R0940:Rif1	UTSW	2	52110324	unclassified	probably benign
R0941:Rif1	UTSW	2	52110324	unclassified	probably benign
R0942:Rif1	UTSW	2	52110324	unclassified	probably benign
R0943:Rif1	UTSW	2	52110324	unclassified	probably benign
R1006:Rif1	UTSW	2	52085029	missense	probably damaging	0.99
R1052:Rif1	UTSW	2	52111562	missense	probably benign	0.01
R1061:Rif1	UTSW	2	52110324	unclassified	probably benign
R1175:Rif1	UTSW	2	52107628	unclassified	probably benign
R1183:Rif1	UTSW	2	52110324	unclassified	probably benign
R1184:Rif1	UTSW	2	52110324	unclassified	probably benign
R1271:Rif1	UTSW	2	52110324	unclassified	probably benign
R1332:Rif1	UTSW	2	52078314	missense	probably benign	0.06
R1336:Rif1	UTSW	2	52078314	missense	probably benign	0.06
R1351:Rif1	UTSW	2	52111555	missense	possibly damaging	0.74
R1517:Rif1	UTSW	2	52110324	unclassified	probably benign
R1527:Rif1	UTSW	2	52110324	unclassified	probably benign
R1560:Rif1	UTSW	2	52111131	missense	probably damaging	1.00
R1563:Rif1	UTSW	2	52073223	missense	probably damaging	0.99
R1571:Rif1	UTSW	2	52110324	unclassified	probably benign
R1625:Rif1	UTSW	2	52103640	missense	probably benign	0.25
R1679:Rif1	UTSW	2	52110324	unclassified	probably benign
R1689:Rif1	UTSW	2	52110324	unclassified	probably benign
R1731:Rif1	UTSW	2	52110324	unclassified	probably benign
R1744:Rif1	UTSW	2	52112392	missense	possibly damaging	0.56
R1746:Rif1	UTSW	2	52110324	unclassified	probably benign
R1748:Rif1	UTSW	2	52110324	unclassified	probably benign
R1831:Rif1	UTSW	2	52078495	nonsense	probably null
R1902:Rif1	UTSW	2	52116673	missense	possibly damaging	0.93
R1964:Rif1	UTSW	2	52098409	missense	probably benign	0.01
R1978:Rif1	UTSW	2	52110324	unclassified	probably benign
R2000:Rif1	UTSW	2	52081298	missense	probably damaging	0.99
R2030:Rif1	UTSW	2	52092346	missense	probably damaging	1.00
R2056:Rif1	UTSW	2	52093576	missense	probably damaging	1.00
R2106:Rif1	UTSW	2	52110324	unclassified	probably benign
R2109:Rif1	UTSW	2	52110324	unclassified	probably benign
R2125:Rif1	UTSW	2	52110324	unclassified	probably benign
R2126:Rif1	UTSW	2	52110324	unclassified	probably benign
R2145:Rif1	UTSW	2	52111400	missense	possibly damaging	0.63
R2152:Rif1	UTSW	2	52110324	unclassified	probably benign
R2153:Rif1	UTSW	2	52110324	unclassified	probably benign
R2213:Rif1	UTSW	2	52110324	unclassified	probably benign
R2327:Rif1	UTSW	2	52110324	unclassified	probably benign
R2512:Rif1	UTSW	2	52110324	unclassified	probably benign
R2513:Rif1	UTSW	2	52110324	unclassified	probably benign
R2520:Rif1	UTSW	2	52110324	unclassified	probably benign
R2905:Rif1	UTSW	2	52098504	missense	probably damaging	0.99
R3005:Rif1	UTSW	2	52082764	missense	probably damaging	1.00
R3155:Rif1	UTSW	2	52110324	unclassified	probably benign
R3156:Rif1	UTSW	2	52110324	unclassified	probably benign
R3429:Rif1	UTSW	2	52110324	unclassified	probably benign
R3707:Rif1	UTSW	2	52093580	missense	probably damaging	1.00
R3907:Rif1	UTSW	2	52112545	missense	probably benign	0.03
R3978:Rif1	UTSW	2	52116747	critical splice donor site	probably null
R4023:Rif1	UTSW	2	52121087	missense	probably benign	0.01
R4052:Rif1	UTSW	2	52098471	nonsense	probably null
R4668:Rif1	UTSW	2	52111952	missense	probably benign	0.01
R4674:Rif1	UTSW	2	52106942	missense	probably null	1.00
R4715:Rif1	UTSW	2	52073139	utr 5 prime	probably benign
R4766:Rif1	UTSW	2	52098934	missense	probably damaging	1.00
R4783:Rif1	UTSW	2	52112747	missense	probably damaging	0.96
R4785:Rif1	UTSW	2	52112747	missense	probably damaging	0.96
R4869:Rif1	UTSW	2	52093611	intron	probably benign
R4911:Rif1	UTSW	2	52110518	missense	probably damaging	0.98
R4951:Rif1	UTSW	2	52084986	splice site	probably null
R5044:Rif1	UTSW	2	52109928	missense	probably damaging	0.99
R5088:Rif1	UTSW	2	52092295	missense	possibly damaging	0.91
R5151:Rif1	UTSW	2	52120309	missense	probably damaging	1.00
R5187:Rif1	UTSW	2	52081289	missense	probably damaging	1.00
R5222:Rif1	UTSW	2	52077020	missense	probably benign	0.08
R5243:Rif1	UTSW	2	52111824	missense	possibly damaging	0.86
R5436:Rif1	UTSW	2	52120971	intron	probably benign
R5476:Rif1	UTSW	2	52089595	missense	probably damaging	1.00
R5496:Rif1	UTSW	2	52098916	missense	probably damaging	1.00
R5641:Rif1	UTSW	2	52121158	missense	possibly damaging	0.80
R5883:Rif1	UTSW	2	52105639	critical splice donor site	probably null
R5987:Rif1	UTSW	2	52095844	missense	probably damaging	1.00
R5990:Rif1	UTSW	2	52095844	missense	probably damaging	1.00
R5992:Rif1	UTSW	2	52095844	missense	probably damaging	1.00
R6019:Rif1	UTSW	2	52095844	missense	probably damaging	1.00
R6020:Rif1	UTSW	2	52095844	missense	probably damaging	1.00
R6255:Rif1	UTSW	2	52085053	missense	probably damaging	1.00
R6342:Rif1	UTSW	2	52119156	missense	probably damaging	0.97
R6364:Rif1	UTSW	2	52107669	missense	probably damaging	0.97
R6747:Rif1	UTSW	2	52078263	splice site	probably null
R6928:Rif1	UTSW	2	52095961	missense	probably damaging	1.00
R6954:Rif1	UTSW	2	52112691	missense	probably benign	0.00
R7003:Rif1	UTSW	2	52076989	missense	probably benign	0.06
R7310:Rif1	UTSW	2	52105619	missense	probably benign	0.12
R7549:Rif1	UTSW	2	52078507	missense	possibly damaging	0.52
R7603:Rif1	UTSW	2	52076175	missense	probably damaging	1.00
R7673:Rif1	UTSW	2	52088654	missense	probably damaging	1.00
R7741:Rif1	UTSW	2	52085141	missense	probably damaging	0.96
R7777:Rif1	UTSW	2	52116356	missense	probably benign	0.00
R7910:Rif1	UTSW	2	52078387	nonsense	probably null
R7962:Rif1	UTSW	2	52074276	missense	probably damaging	1.00
R8264:Rif1	UTSW	2	52090278	missense	noncoding transcript
R8390:Rif1	UTSW	2	52110923	missense	probably damaging	1.00
R8479:Rif1	UTSW	2	52112551	missense	possibly damaging	0.52
R8490:Rif1	UTSW	2	52110999	missense	probably damaging	0.96
R8762:Rif1	UTSW	2	52111730	missense
R8785:Rif1	UTSW	2	52110481	missense	probably benign	0.06
R8890:Rif1	UTSW	2	52098863	missense	probably damaging	0.99
R9081:Rif1	UTSW	2	52110977	missense	probably damaging	0.99
R9225:Rif1	UTSW	2	52111850	missense	probably benign	0.22
R9284:Rif1	UTSW	2	52108552	missense	probably benign	0.00
R9300:Rif1	UTSW	2	52111139	missense	probably damaging	1.00
R9366:Rif1	UTSW	2	52120344	missense
R9477:Rif1	UTSW	2	52111330	missense	probably benign	0.02
R9522:Rif1	UTSW	2	52081299	missense	probably damaging	1.00
R9573:Rif1	UTSW	2	52110454	missense	probably benign	0.29
R9630:Rif1	UTSW	2	52089595	missense	probably damaging	1.00
X0064:Rif1	UTSW	2	52074315	missense	probably benign	0.00
X0064:Rif1	UTSW	2	52094633	missense	probably damaging	0.96
Z1177:Rif1	UTSW	2	52088648	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGTCAGCAGTAGTTCAGTTTC -3'
(R):5'- TGACACATGTTCTGTTGGGC -3'

Sequencing Primer
(F):5'- GCAGTAGTTCAGTTTCTAATGCCAC -3'
(R):5'- AGCAGATCAGGAGAGTTATTTTCG -3'

Posted On

2014-12-04