Incidental Mutation 'R2871:Sfi1'
ID 253748
Institutional Source Beutler Lab
Gene Symbol Sfi1
Ensembl Gene ENSMUSG00000023764
Gene Name Sfi1 homolog, spindle assembly associated (yeast)
Synonyms 2310047I15Rik
MMRRC Submission 040459-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.243) question?
Stock # R2871 (G1)
Quality Score 214
Status Not validated
Chromosome 11
Chromosomal Location 3081850-3143463 bp(-) (GRCm39)
Type of Mutation critical splice donor site
DNA Base Change (assembly) CCTCTC to CCTCTCTC at 3127419 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066391] [ENSMUST00000081318] [ENSMUST00000101655] [ENSMUST00000132893] [ENSMUST00000140846] [ENSMUST00000155763] [ENSMUST00000142315] [ENSMUST00000153425]
AlphaFold Q3UZY0
Predicted Effect probably benign
Transcript: ENSMUST00000066391
SMART Domains Protein: ENSMUSP00000067261
Gene: ENSMUSG00000023764

DomainStartEndE-ValueType
internal_repeat_2 34 236 4.95e-5 PROSPERO
internal_repeat_1 78 336 3.02e-14 PROSPERO
low complexity region 342 358 N/A INTRINSIC
internal_repeat_1 372 636 3.02e-14 PROSPERO
internal_repeat_2 574 804 4.95e-5 PROSPERO
low complexity region 809 821 N/A INTRINSIC
low complexity region 849 860 N/A INTRINSIC
coiled coil region 1086 1112 N/A INTRINSIC
coiled coil region 1138 1168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081318
SMART Domains Protein: ENSMUSP00000080066
Gene: ENSMUSG00000023764

DomainStartEndE-ValueType
internal_repeat_3 55 275 2e-6 PROSPERO
internal_repeat_1 67 288 7.56e-9 PROSPERO
internal_repeat_2 93 401 1.18e-6 PROSPERO
internal_repeat_3 380 607 2e-6 PROSPERO
internal_repeat_1 428 651 7.56e-9 PROSPERO
internal_repeat_2 524 836 1.18e-6 PROSPERO
low complexity region 841 853 N/A INTRINSIC
low complexity region 881 892 N/A INTRINSIC
coiled coil region 1118 1144 N/A INTRINSIC
coiled coil region 1170 1200 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101655
SMART Domains Protein: ENSMUSP00000099178
Gene: ENSMUSG00000023764

DomainStartEndE-ValueType
internal_repeat_3 55 275 1.77e-6 PROSPERO
internal_repeat_1 67 288 6.51e-9 PROSPERO
internal_repeat_2 93 401 1.04e-6 PROSPERO
internal_repeat_3 380 607 1.77e-6 PROSPERO
internal_repeat_1 428 651 6.51e-9 PROSPERO
internal_repeat_2 524 836 1.04e-6 PROSPERO
low complexity region 841 853 N/A INTRINSIC
low complexity region 881 892 N/A INTRINSIC
coiled coil region 1107 1133 N/A INTRINSIC
coiled coil region 1159 1189 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132893
SMART Domains Protein: ENSMUSP00000118419
Gene: ENSMUSG00000023764

DomainStartEndE-ValueType
low complexity region 210 223 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138126
Predicted Effect probably benign
Transcript: ENSMUST00000140846
SMART Domains Protein: ENSMUSP00000119905
Gene: ENSMUSG00000023764

DomainStartEndE-ValueType
internal_repeat_1 3 301 3.65e-15 PROSPERO
internal_repeat_2 12 320 8.53e-7 PROSPERO
internal_repeat_1 301 599 3.65e-15 PROSPERO
internal_repeat_2 443 755 8.53e-7 PROSPERO
low complexity region 760 772 N/A INTRINSIC
low complexity region 800 811 N/A INTRINSIC
coiled coil region 1026 1052 N/A INTRINSIC
coiled coil region 1078 1108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141422
Predicted Effect probably benign
Transcript: ENSMUST00000142315
SMART Domains Protein: ENSMUSP00000118364
Gene: ENSMUSG00000023764

DomainStartEndE-ValueType
low complexity region 64 77 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144359
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144778
Predicted Effect probably benign
Transcript: ENSMUST00000153425
SMART Domains Protein: ENSMUSP00000121719
Gene: ENSMUSG00000023764

DomainStartEndE-ValueType
internal_repeat_1 67 288 6.06e-9 PROSPERO
internal_repeat_3 69 314 2.4e-5 PROSPERO
internal_repeat_2 93 340 2.83e-6 PROSPERO
low complexity region 342 358 N/A INTRINSIC
internal_repeat_1 397 620 6.06e-9 PROSPERO
internal_repeat_2 493 744 2.83e-6 PROSPERO
internal_repeat_3 531 799 2.4e-5 PROSPERO
low complexity region 810 822 N/A INTRINSIC
low complexity region 850 861 N/A INTRINSIC
coiled coil region 1076 1102 N/A INTRINSIC
coiled coil region 1128 1158 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143442
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.2%
  • 10x: 92.4%
  • 20x: 72.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,846,002 (GRCm39) C811R possibly damaging Het
Akap8l G A 17: 32,557,416 (GRCm39) T65I possibly damaging Het
Arid4a T A 12: 71,069,034 (GRCm39) probably null Het
Armc2 C T 10: 41,842,696 (GRCm39) probably null Het
Atp6v1g1 A G 4: 63,468,258 (GRCm39) Y87C probably benign Het
Cfap54 A T 10: 92,757,281 (GRCm39) F273I possibly damaging Het
Clasrp C A 7: 19,319,165 (GRCm39) probably benign Het
Csmd2 T C 4: 128,451,511 (GRCm39) F113S unknown Het
Cyp4a14 C A 4: 115,344,498 (GRCm39) G456W probably damaging Het
Cyp4a30b A G 4: 115,315,559 (GRCm39) H260R possibly damaging Het
Ddrgk1 T A 2: 130,506,564 (GRCm39) probably benign Het
Dennd2b A T 7: 109,156,637 (GRCm39) Y38N probably benign Het
Dhx57 A T 17: 80,558,805 (GRCm39) D1051E probably benign Het
Eef2 GCCC GCCCC 10: 81,014,601 (GRCm39) probably null Het
Eif4enif1 C T 11: 3,192,586 (GRCm39) P805S probably damaging Het
Eml5 C T 12: 98,831,660 (GRCm39) D433N probably damaging Het
Fan1 A G 7: 64,012,938 (GRCm39) I668T probably benign Het
Frmpd4 A T X: 166,260,243 (GRCm39) D1166E probably benign Het
Ftdc1 A T 16: 58,434,342 (GRCm39) I125K probably benign Het
Gria2 G A 3: 80,609,799 (GRCm39) T670I probably damaging Het
Grid2ip C A 5: 143,343,684 (GRCm39) Q127K probably benign Het
Hdhd2 T C 18: 77,042,702 (GRCm39) F44L probably damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hmcn1 A T 1: 150,614,467 (GRCm39) V1313D possibly damaging Het
Ift172 C T 5: 31,415,205 (GRCm39) V1335I probably benign Het
Ighv2-2 G A 12: 113,552,118 (GRCm39) T40I possibly damaging Het
Kcnk10 T A 12: 98,401,072 (GRCm39) R520S probably benign Het
Kif1c A G 11: 70,614,907 (GRCm39) E567G probably damaging Het
Klf8 A T X: 152,165,678 (GRCm39) E82D probably damaging Het
Kpna7 T C 5: 144,930,745 (GRCm39) T367A probably benign Het
Lpo A G 11: 87,707,350 (GRCm39) I221T possibly damaging Het
Lrrn3 T C 12: 41,502,722 (GRCm39) I532V probably benign Het
Matr3 T A 18: 35,705,349 (GRCm39) S91R probably benign Het
Mki67 G A 7: 135,309,878 (GRCm39) P191L probably benign Het
Mlxip A G 5: 123,590,730 (GRCm39) M878V probably benign Het
Mpp7 G A 18: 7,461,678 (GRCm39) P65L possibly damaging Het
Mroh2a C A 1: 88,183,287 (GRCm39) L1292I probably damaging Het
Msh2 C A 17: 87,993,012 (GRCm39) Q314K possibly damaging Het
Mtor T A 4: 148,624,487 (GRCm39) M2089K probably benign Het
Myo9b G A 8: 71,786,981 (GRCm39) R721Q probably benign Het
Nlrp4b C T 7: 10,444,170 (GRCm39) Q40* probably null Het
Nomo1 C A 7: 45,696,361 (GRCm39) T293N probably damaging Het
Notum A G 11: 120,551,022 (GRCm39) V48A probably benign Het
Npas3 C T 12: 54,114,796 (GRCm39) R542* probably null Het
Or10z1 T C 1: 174,078,092 (GRCm39) S134G probably benign Het
Or13a17 A G 7: 140,271,198 (GRCm39) I127V possibly damaging Het
Or13j1 C A 4: 43,706,458 (GRCm39) V37L probably benign Het
Or5t16 A T 2: 86,819,192 (GRCm39) C109* probably null Het
Ostc T C 3: 130,497,157 (GRCm39) N80S probably damaging Het
Palmd T C 3: 116,717,400 (GRCm39) R366G possibly damaging Het
Parp1 A G 1: 180,401,230 (GRCm39) D45G probably damaging Het
Pcdhga9 T A 18: 37,870,524 (GRCm39) Y118N possibly damaging Het
Pes1 C A 11: 3,926,834 (GRCm39) T372K probably benign Het
Pkp4 C A 2: 59,138,500 (GRCm39) T250K probably benign Het
Plekhg5 T A 4: 152,191,960 (GRCm39) C433S probably benign Het
Plin2 A G 4: 86,586,915 (GRCm39) M1T probably null Het
Prdx4 A G X: 154,123,460 (GRCm39) V15A probably benign Het
Psmb8 T C 17: 34,419,144 (GRCm39) I146T probably damaging Het
Psmd13 A T 7: 140,466,968 (GRCm39) T116S probably damaging Het
Rel T C 11: 23,711,129 (GRCm39) I13V probably benign Het
Reln C T 5: 22,254,789 (GRCm39) V527I possibly damaging Het
Rnf6 T C 5: 146,147,215 (GRCm39) Y601C probably benign Het
Rps6kc1 T C 1: 190,631,766 (GRCm39) I48M probably damaging Het
Shoc1 A C 4: 59,093,850 (GRCm39) L226R probably damaging Het
Slc39a8 T A 3: 135,592,554 (GRCm39) probably null Het
Sppl2c C T 11: 104,078,141 (GRCm39) P314S probably benign Het
Tnni3k C T 3: 154,644,387 (GRCm39) probably null Het
Ugt1a1 AT A 1: 88,140,093 (GRCm39) probably null Het
Vmn2r68 A C 7: 84,882,834 (GRCm39) M306R probably benign Het
Vmn2r70 T A 7: 85,208,227 (GRCm39) Y750F probably damaging Het
Vwa7 G A 17: 35,240,218 (GRCm39) M395I probably damaging Het
Zfp53 A T 17: 21,728,340 (GRCm39) E124D probably benign Het
Other mutations in Sfi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Sfi1 APN 11 3,093,689 (GRCm39) splice site probably benign
IGL00990:Sfi1 APN 11 3,084,337 (GRCm39) missense probably benign 0.05
IGL00990:Sfi1 APN 11 3,085,671 (GRCm39) missense probably damaging 0.99
IGL03147:Sfi1 UTSW 11 3,136,080 (GRCm39) missense possibly damaging 0.94
R0081:Sfi1 UTSW 11 3,096,254 (GRCm39) frame shift probably null
R0082:Sfi1 UTSW 11 3,096,254 (GRCm39) frame shift probably null
R0118:Sfi1 UTSW 11 3,127,419 (GRCm39) critical splice donor site probably benign
R0197:Sfi1 UTSW 11 3,096,254 (GRCm39) frame shift probably null
R0241:Sfi1 UTSW 11 3,127,419 (GRCm39) critical splice donor site probably benign
R0241:Sfi1 UTSW 11 3,127,419 (GRCm39) critical splice donor site probably benign
R0242:Sfi1 UTSW 11 3,127,419 (GRCm39) critical splice donor site probably benign
R0816:Sfi1 UTSW 11 3,096,254 (GRCm39) frame shift probably null
R1147:Sfi1 UTSW 11 3,127,419 (GRCm39) critical splice donor site probably benign
R1148:Sfi1 UTSW 11 3,127,419 (GRCm39) critical splice donor site probably benign
R1148:Sfi1 UTSW 11 3,096,254 (GRCm39) frame shift probably null
R1185:Sfi1 UTSW 11 3,127,419 (GRCm39) critical splice donor site probably benign
R1185:Sfi1 UTSW 11 3,096,254 (GRCm39) frame shift probably null
R1207:Sfi1 UTSW 11 3,127,419 (GRCm39) critical splice donor site probably benign
R1207:Sfi1 UTSW 11 3,096,254 (GRCm39) frame shift probably null
R1207:Sfi1 UTSW 11 3,096,255 (GRCm39) frame shift probably null
R1403:Sfi1 UTSW 11 3,127,419 (GRCm39) critical splice donor site probably benign
R1403:Sfi1 UTSW 11 3,096,254 (GRCm39) frame shift probably null
R1404:Sfi1 UTSW 11 3,127,419 (GRCm39) critical splice donor site probably benign
R1404:Sfi1 UTSW 11 3,096,254 (GRCm39) frame shift probably null
R1405:Sfi1 UTSW 11 3,127,419 (GRCm39) critical splice donor site probably benign
R1405:Sfi1 UTSW 11 3,096,254 (GRCm39) frame shift probably null
R1465:Sfi1 UTSW 11 3,096,254 (GRCm39) frame shift probably null
R1469:Sfi1 UTSW 11 3,127,419 (GRCm39) critical splice donor site probably benign
R1470:Sfi1 UTSW 11 3,096,254 (GRCm39) frame shift probably null
R1470:Sfi1 UTSW 11 3,096,255 (GRCm39) frame shift probably null
R1574:Sfi1 UTSW 11 3,096,254 (GRCm39) frame shift probably null
R5228:Sfi1 UTSW 11 3,103,384 (GRCm39) intron probably benign
R5276:Sfi1 UTSW 11 3,103,384 (GRCm39) intron probably benign
R5298:Sfi1 UTSW 11 3,103,384 (GRCm39) intron probably benign
R5343:Sfi1 UTSW 11 3,103,384 (GRCm39) intron probably benign
R5376:Sfi1 UTSW 11 3,103,384 (GRCm39) intron probably benign
R5384:Sfi1 UTSW 11 3,103,382 (GRCm39) intron probably benign
R5385:Sfi1 UTSW 11 3,103,382 (GRCm39) intron probably benign
R5386:Sfi1 UTSW 11 3,103,384 (GRCm39) intron probably benign
R5411:Sfi1 UTSW 11 3,103,384 (GRCm39) intron probably benign
R5431:Sfi1 UTSW 11 3,103,384 (GRCm39) intron probably benign
R5795:Sfi1 UTSW 11 3,103,384 (GRCm39) intron probably benign
R5808:Sfi1 UTSW 11 3,103,384 (GRCm39) intron probably benign
R7536:Sfi1 UTSW 11 3,103,382 (GRCm39) intron probably benign
R7642:Sfi1 UTSW 11 3,103,382 (GRCm39) intron probably benign
R8111:Sfi1 UTSW 11 3,096,254 (GRCm39) frame shift probably null
R8891:Sfi1 UTSW 11 3,103,384 (GRCm39) intron probably benign
R8977:Sfi1 UTSW 11 3,103,382 (GRCm39) intron probably benign
R9118:Sfi1 UTSW 11 3,103,382 (GRCm39) intron probably benign
R9170:Sfi1 UTSW 11 3,103,384 (GRCm39) intron probably benign
R9385:Sfi1 UTSW 11 3,103,382 (GRCm39) intron probably benign
R9559:Sfi1 UTSW 11 3,103,382 (GRCm39) intron probably benign
R9560:Sfi1 UTSW 11 3,103,382 (GRCm39) intron probably benign
R9715:Sfi1 UTSW 11 3,103,382 (GRCm39) intron probably benign
Z1186:Sfi1 UTSW 11 3,103,382 (GRCm39) intron probably benign
Predicted Primers PCR Primer
(F):5'- GCTACACTATGGGAGAACAATTGTG -3'
(R):5'- ACTAAGTGTAGCCGTGACTGG -3'

Sequencing Primer
(F):5'- GCTTTGCTGAGTTTAAGGCAAACC -3'
(R):5'- CCGTGACTGGGTAGGAGTTAC -3'
Posted On 2014-12-04