Incidental Mutation 'R2516:Ptprj'
ID253749
Institutional Source Beutler Lab
Gene Symbol Ptprj
Ensembl Gene ENSMUSG00000025314
Gene Nameprotein tyrosine phosphatase, receptor type, J
SynonymsCD148, Byp, Scc1, Scc-1, DEP-1, RPTPJ
MMRRC Submission 040420-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.247) question?
Stock #R2516 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location90429754-90580647 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 90474996 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111493] [ENSMUST00000111495] [ENSMUST00000168621]
Predicted Effect probably benign
Transcript: ENSMUST00000111493
SMART Domains Protein: ENSMUSP00000107119
Gene: ENSMUSG00000025314

DomainStartEndE-ValueType
low complexity region 34 46 N/A INTRINSIC
FN3 47 182 3.76e-6 SMART
FN3 194 271 4.56e-5 SMART
FN3 282 357 5.32e-6 SMART
FN3 368 446 2.19e-7 SMART
FN3 455 531 5e-2 SMART
FN3 546 628 2.77e1 SMART
low complexity region 637 650 N/A INTRINSIC
Blast:PTPc 714 797 8e-26 BLAST
PTPc 867 1127 3.37e-133 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111495
SMART Domains Protein: ENSMUSP00000107121
Gene: ENSMUSG00000025314

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
FN3 59 131 2.85e-6 SMART
FN3 140 275 3.76e-6 SMART
FN3 287 364 4.56e-5 SMART
FN3 375 450 5.32e-6 SMART
FN3 461 539 2.19e-7 SMART
FN3 548 624 5e-2 SMART
FN3 639 721 2.77e1 SMART
low complexity region 730 743 N/A INTRINSIC
Blast:PTPc 807 890 1e-25 BLAST
PTPc 960 1220 3.37e-133 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126953
Predicted Effect probably benign
Transcript: ENSMUST00000168621
SMART Domains Protein: ENSMUSP00000129592
Gene: ENSMUSG00000025314

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
low complexity region 26 94 N/A INTRINSIC
low complexity region 133 140 N/A INTRINSIC
FN3 152 224 2.85e-6 SMART
FN3 233 368 3.76e-6 SMART
FN3 380 457 4.56e-5 SMART
FN3 468 543 5.32e-6 SMART
FN3 554 632 2.19e-7 SMART
FN3 641 717 5e-2 SMART
FN3 732 814 2.77e1 SMART
low complexity region 823 836 N/A INTRINSIC
Blast:PTPc 900 983 1e-25 BLAST
PTPc 1053 1313 3.37e-133 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes, including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region containing five fibronectin type III repeats, a single transmembrane region, and a single intracytoplasmic catalytic domain, and thus represents a receptor-type PTP. This protein is present in all hematopoietic lineages, and was shown to negatively regulate T cell receptor signaling possibly through interfering with the phosphorylation of Phospholipase C Gamma 1 and Linker for Activation of T Cells. This protein can also dephosphorylate the PDGF beta receptor, and may be involved in UV-induced signal transduction. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele die in utero displaying severe growth retardation and cardiovascular defects. Homozygotes for a second null allele are viable, fertile and healthy with no spontaneous tumor formation. Homozygotes for a third null allele show sterility and a block B cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,329,329 I6N possibly damaging Het
Aen T C 7: 78,905,868 V188A probably damaging Het
Afg3l1 A G 8: 123,501,954 E753G probably damaging Het
Alas1 G A 9: 106,238,660 T385I probably damaging Het
Alms1 C A 6: 85,667,963 probably benign Het
Ankrd65 A G 4: 155,791,411 T30A possibly damaging Het
App T C 16: 84,978,229 S582G probably damaging Het
Arfgef1 A T 1: 10,153,654 V1473E possibly damaging Het
Arhgap21 G A 2: 20,854,998 P1196S probably damaging Het
Arhgap24 A G 5: 102,891,910 T238A probably benign Het
Atf7 T C 15: 102,529,004 probably benign Het
Best1 G T 19: 9,993,311 S55* probably null Het
Capn11 A G 17: 45,633,799 V514A probably damaging Het
Cep104 T A 4: 153,989,146 M52K probably damaging Het
Clca3a1 C T 3: 144,737,858 probably null Het
Cyp3a25 T C 5: 146,003,027 probably null Het
Dmxl2 G A 9: 54,400,094 P2197S probably damaging Het
Drosha T C 15: 12,859,465 probably null Het
Exosc9 A G 3: 36,563,162 K355R probably benign Het
Fut1 A C 7: 45,619,198 H192P probably benign Het
Gm572 T A 4: 148,664,384 V166D possibly damaging Het
Gm9966 C T 7: 95,958,528 P19S unknown Het
Gmds C T 13: 32,100,473 V219I probably damaging Het
Gsn G A 2: 35,283,953 E25K probably benign Het
Il4i1 T C 7: 44,839,891 F368S probably damaging Het
Irak1bp1 T C 9: 82,830,320 L98P probably damaging Het
Khdrbs3 T C 15: 69,024,695 probably benign Het
Kndc1 T C 7: 139,921,822 I925T probably damaging Het
Laptm4a T C 12: 8,938,151 I296T probably benign Het
Lpl A T 8: 68,887,518 H55L probably benign Het
Lrrk2 C A 15: 91,755,927 N1558K probably benign Het
Mfsd2a A G 4: 122,950,487 L289P probably damaging Het
Mmrn2 T A 14: 34,398,802 M543K probably benign Het
Mnat1 T C 12: 73,181,776 probably benign Het
Msto1 A T 3: 88,911,893 probably null Het
Mtus1 A G 8: 41,082,739 Y647H probably damaging Het
Nars A T 18: 64,505,016 V289E probably damaging Het
Oit3 T A 10: 59,428,345 K322N probably damaging Het
Oit3 G A 10: 59,441,685 probably benign Het
Olfr1024 A G 2: 85,904,556 I166T probably benign Het
Olfr1467 T A 19: 13,365,193 C188* probably null Het
Olfr728 T C 14: 50,139,983 I219V probably benign Het
Olfr801 G A 10: 129,670,286 R78W probably damaging Het
Pecr A T 1: 72,277,310 C79S probably damaging Het
Plekhn1 T C 4: 156,222,659 D478G probably damaging Het
Pls1 A T 9: 95,776,563 M264K probably benign Het
Pygm A G 19: 6,397,601 D646G probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scn8a T C 15: 100,969,162 V283A probably benign Het
Shisa5 T C 9: 109,056,507 probably null Het
Slc10a4 A G 5: 73,008,505 I246V possibly damaging Het
Slc1a1 A T 19: 28,892,912 I104F probably benign Het
Slc22a8 A G 19: 8,610,195 Y511C probably benign Het
Slc6a5 A G 7: 49,956,462 N706S probably benign Het
Sos2 T C 12: 69,650,659 K96E probably damaging Het
Stom G A 2: 35,315,965 R251* probably null Het
Sycp1 T C 3: 102,845,066 E800G probably benign Het
Tab2 G A 10: 7,907,481 P679L probably damaging Het
Tiam2 G A 17: 3,453,382 V945I probably damaging Het
Trpm5 G T 7: 143,074,517 P1007Q probably damaging Het
Uchl1 T G 5: 66,682,613 I139S probably damaging Het
Vmn1r232 A G 17: 20,914,026 I104T possibly damaging Het
Vmn2r97 G A 17: 18,947,552 M689I probably benign Het
Zc3h18 A T 8: 122,403,165 probably benign Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp456 T C 13: 67,362,372 K99R probably benign Het
Other mutations in Ptprj
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01528:Ptprj APN 2 90452144 missense probably damaging 1.00
IGL01594:Ptprj APN 2 90440795 splice site probably benign
IGL01767:Ptprj APN 2 90469574 missense probably benign 0.11
IGL01917:Ptprj APN 2 90469749 missense probably damaging 1.00
IGL01981:Ptprj APN 2 90439912 missense probably damaging 1.00
IGL02830:Ptprj APN 2 90453144 missense probably benign 0.22
IGL02955:Ptprj APN 2 90468464 critical splice acceptor site probably null
IGL03102:Ptprj APN 2 90478968 missense probably benign 0.02
IGL03150:Ptprj APN 2 90460611 missense probably damaging 0.98
IGL03210:Ptprj APN 2 90469726 missense probably benign 0.01
IGL02799:Ptprj UTSW 2 90469598 missense probably benign 0.00
R0083:Ptprj UTSW 2 90469777 intron probably null
R0108:Ptprj UTSW 2 90469777 intron probably null
R0579:Ptprj UTSW 2 90436569 critical splice acceptor site probably null
R1130:Ptprj UTSW 2 90453421 missense probably damaging 1.00
R1160:Ptprj UTSW 2 90444524 missense probably damaging 1.00
R1238:Ptprj UTSW 2 90444414 splice site probably null
R1507:Ptprj UTSW 2 90471287 missense possibly damaging 0.87
R1552:Ptprj UTSW 2 90471153 missense probably damaging 0.98
R1607:Ptprj UTSW 2 90463320 missense probably benign 0.14
R1693:Ptprj UTSW 2 90449797 nonsense probably null
R2016:Ptprj UTSW 2 90464614 missense probably damaging 1.00
R2017:Ptprj UTSW 2 90464614 missense probably damaging 1.00
R2044:Ptprj UTSW 2 90463095 missense probably damaging 0.96
R2322:Ptprj UTSW 2 90471129 missense probably benign 0.06
R3106:Ptprj UTSW 2 90440631 missense probably damaging 1.00
R3964:Ptprj UTSW 2 90468441 missense probably benign 0.00
R4201:Ptprj UTSW 2 90463095 missense probably damaging 0.99
R4533:Ptprj UTSW 2 90439955 missense probably damaging 1.00
R4680:Ptprj UTSW 2 90460496 missense probably benign 0.00
R4738:Ptprj UTSW 2 90440643 missense probably damaging 1.00
R4983:Ptprj UTSW 2 90460532 missense probably damaging 0.98
R5137:Ptprj UTSW 2 90469648 missense possibly damaging 0.70
R5349:Ptprj UTSW 2 90471261 missense probably benign 0.00
R5369:Ptprj UTSW 2 90469641 missense probably benign 0.09
R5718:Ptprj UTSW 2 90458269 missense probably benign 0.00
R5914:Ptprj UTSW 2 90453340 missense possibly damaging 0.81
R6022:Ptprj UTSW 2 90471323 missense probably benign 0.14
R6341:Ptprj UTSW 2 90458349 missense probably benign
R6421:Ptprj UTSW 2 90471140 missense possibly damaging 0.62
R6724:Ptprj UTSW 2 90450851 missense probably benign 0.04
R6831:Ptprj UTSW 2 90460647 missense probably damaging 1.00
R6939:Ptprj UTSW 2 90459514 missense possibly damaging 0.68
R6972:Ptprj UTSW 2 90580403 missense possibly damaging 0.91
R7134:Ptprj UTSW 2 90464478 missense probably benign 0.16
R7149:Ptprj UTSW 2 90444446 missense possibly damaging 0.95
R7243:Ptprj UTSW 2 90446421 missense probably damaging 0.96
R7335:Ptprj UTSW 2 90440782 missense probably benign 0.01
R7439:Ptprj UTSW 2 90449819 missense possibly damaging 0.82
R7441:Ptprj UTSW 2 90449819 missense possibly damaging 0.82
R7498:Ptprj UTSW 2 90436565 nonsense probably null
R7571:Ptprj UTSW 2 90455186 missense probably benign 0.24
R7672:Ptprj UTSW 2 90460596 missense possibly damaging 0.49
RF013:Ptprj UTSW 2 90471170 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTGAATGCTCCTTTCACTTACAG -3'
(R):5'- CCTCAGTGAACCCAGTTAATCTTTTG -3'

Sequencing Primer
(F):5'- AGGCTAGTGCTCTTAACCACTGAG -3'
(R):5'- GTATAGTTGACTTGCTCTTTCCCTG -3'
Posted On2014-12-04