Incidental Mutation 'R2871:Eif4enif1'
ID 253750
Institutional Source Beutler Lab
Gene Symbol Eif4enif1
Ensembl Gene ENSMUSG00000020454
Gene Name eukaryotic translation initiation factor 4E nuclear import factor 1
Synonyms D11Ertd166e, 2610509L04Rik, Clast4, A930019J01Rik
MMRRC Submission 040459-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.494) question?
Stock # R2871 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 3152392-3194588 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 3192586 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 805 (P805S)
Ref Sequence ENSEMBL: ENSMUSP00000136768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020734] [ENSMUST00000110048] [ENSMUST00000110049] [ENSMUST00000120721] [ENSMUST00000135223] [ENSMUST00000179770]
AlphaFold Q9EST3
Predicted Effect probably damaging
Transcript: ENSMUST00000020734
AA Change: P781S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020734
Gene: ENSMUSG00000020454
AA Change: P781S

DomainStartEndE-ValueType
Pfam:EIF4E-T 29 688 1.2e-189 PFAM
low complexity region 835 851 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110048
AA Change: P781S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105675
Gene: ENSMUSG00000020454
AA Change: P781S

DomainStartEndE-ValueType
Pfam:EIF4E-T 29 688 1.2e-189 PFAM
low complexity region 835 851 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110049
AA Change: P805S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105676
Gene: ENSMUSG00000020454
AA Change: P805S

DomainStartEndE-ValueType
Pfam:EIF4E-T 29 712 2.7e-184 PFAM
low complexity region 859 875 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120721
AA Change: P630S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112550
Gene: ENSMUSG00000020454
AA Change: P630S

DomainStartEndE-ValueType
Pfam:EIF4E-T 29 99 3.6e-29 PFAM
Pfam:EIF4E-T 98 327 5.1e-41 PFAM
Pfam:EIF4E-T 282 537 7.7e-30 PFAM
low complexity region 684 700 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127950
Predicted Effect probably benign
Transcript: ENSMUST00000135223
SMART Domains Protein: ENSMUSP00000122912
Gene: ENSMUSG00000020454

DomainStartEndE-ValueType
Pfam:EIF4E-T 1 239 1.5e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147534
Predicted Effect probably benign
Transcript: ENSMUST00000159304
SMART Domains Protein: ENSMUSP00000125536
Gene: ENSMUSG00000020457

DomainStartEndE-ValueType
Pfam:TGS 13 58 5.7e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179770
AA Change: P805S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136768
Gene: ENSMUSG00000020454
AA Change: P805S

DomainStartEndE-ValueType
Pfam:EIF4E-T 29 710 4.3e-160 PFAM
low complexity region 859 875 N/A INTRINSIC
Meta Mutation Damage Score 0.1682 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.2%
  • 10x: 92.4%
  • 20x: 72.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nucleocytoplasmic shuttle protein for the translation initiation factor eIF4E. This shuttle protein interacts with the importin alpha-beta complex to mediate nuclear import of eIF4E. It is predominantly cytoplasmic; its own nuclear import is regulated by a nuclear localization signal and nuclear export signals. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,846,002 (GRCm39) C811R possibly damaging Het
Akap8l G A 17: 32,557,416 (GRCm39) T65I possibly damaging Het
Arid4a T A 12: 71,069,034 (GRCm39) probably null Het
Armc2 C T 10: 41,842,696 (GRCm39) probably null Het
Atp6v1g1 A G 4: 63,468,258 (GRCm39) Y87C probably benign Het
Cfap54 A T 10: 92,757,281 (GRCm39) F273I possibly damaging Het
Clasrp C A 7: 19,319,165 (GRCm39) probably benign Het
Csmd2 T C 4: 128,451,511 (GRCm39) F113S unknown Het
Cyp4a14 C A 4: 115,344,498 (GRCm39) G456W probably damaging Het
Cyp4a30b A G 4: 115,315,559 (GRCm39) H260R possibly damaging Het
Ddrgk1 T A 2: 130,506,564 (GRCm39) probably benign Het
Dennd2b A T 7: 109,156,637 (GRCm39) Y38N probably benign Het
Dhx57 A T 17: 80,558,805 (GRCm39) D1051E probably benign Het
Eef2 GCCC GCCCC 10: 81,014,601 (GRCm39) probably null Het
Eml5 C T 12: 98,831,660 (GRCm39) D433N probably damaging Het
Fan1 A G 7: 64,012,938 (GRCm39) I668T probably benign Het
Frmpd4 A T X: 166,260,243 (GRCm39) D1166E probably benign Het
Ftdc1 A T 16: 58,434,342 (GRCm39) I125K probably benign Het
Gria2 G A 3: 80,609,799 (GRCm39) T670I probably damaging Het
Grid2ip C A 5: 143,343,684 (GRCm39) Q127K probably benign Het
Hdhd2 T C 18: 77,042,702 (GRCm39) F44L probably damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hmcn1 A T 1: 150,614,467 (GRCm39) V1313D possibly damaging Het
Ift172 C T 5: 31,415,205 (GRCm39) V1335I probably benign Het
Ighv2-2 G A 12: 113,552,118 (GRCm39) T40I possibly damaging Het
Kcnk10 T A 12: 98,401,072 (GRCm39) R520S probably benign Het
Kif1c A G 11: 70,614,907 (GRCm39) E567G probably damaging Het
Klf8 A T X: 152,165,678 (GRCm39) E82D probably damaging Het
Kpna7 T C 5: 144,930,745 (GRCm39) T367A probably benign Het
Lpo A G 11: 87,707,350 (GRCm39) I221T possibly damaging Het
Lrrn3 T C 12: 41,502,722 (GRCm39) I532V probably benign Het
Matr3 T A 18: 35,705,349 (GRCm39) S91R probably benign Het
Mki67 G A 7: 135,309,878 (GRCm39) P191L probably benign Het
Mlxip A G 5: 123,590,730 (GRCm39) M878V probably benign Het
Mpp7 G A 18: 7,461,678 (GRCm39) P65L possibly damaging Het
Mroh2a C A 1: 88,183,287 (GRCm39) L1292I probably damaging Het
Msh2 C A 17: 87,993,012 (GRCm39) Q314K possibly damaging Het
Mtor T A 4: 148,624,487 (GRCm39) M2089K probably benign Het
Myo9b G A 8: 71,786,981 (GRCm39) R721Q probably benign Het
Nlrp4b C T 7: 10,444,170 (GRCm39) Q40* probably null Het
Nomo1 C A 7: 45,696,361 (GRCm39) T293N probably damaging Het
Notum A G 11: 120,551,022 (GRCm39) V48A probably benign Het
Npas3 C T 12: 54,114,796 (GRCm39) R542* probably null Het
Or10z1 T C 1: 174,078,092 (GRCm39) S134G probably benign Het
Or13a17 A G 7: 140,271,198 (GRCm39) I127V possibly damaging Het
Or13j1 C A 4: 43,706,458 (GRCm39) V37L probably benign Het
Or5t16 A T 2: 86,819,192 (GRCm39) C109* probably null Het
Ostc T C 3: 130,497,157 (GRCm39) N80S probably damaging Het
Palmd T C 3: 116,717,400 (GRCm39) R366G possibly damaging Het
Parp1 A G 1: 180,401,230 (GRCm39) D45G probably damaging Het
Pcdhga9 T A 18: 37,870,524 (GRCm39) Y118N possibly damaging Het
Pes1 C A 11: 3,926,834 (GRCm39) T372K probably benign Het
Pkp4 C A 2: 59,138,500 (GRCm39) T250K probably benign Het
Plekhg5 T A 4: 152,191,960 (GRCm39) C433S probably benign Het
Plin2 A G 4: 86,586,915 (GRCm39) M1T probably null Het
Prdx4 A G X: 154,123,460 (GRCm39) V15A probably benign Het
Psmb8 T C 17: 34,419,144 (GRCm39) I146T probably damaging Het
Psmd13 A T 7: 140,466,968 (GRCm39) T116S probably damaging Het
Rel T C 11: 23,711,129 (GRCm39) I13V probably benign Het
Reln C T 5: 22,254,789 (GRCm39) V527I possibly damaging Het
Rnf6 T C 5: 146,147,215 (GRCm39) Y601C probably benign Het
Rps6kc1 T C 1: 190,631,766 (GRCm39) I48M probably damaging Het
Sfi1 CCTCTC CCTCTCTC 11: 3,127,419 (GRCm39) probably benign Het
Shoc1 A C 4: 59,093,850 (GRCm39) L226R probably damaging Het
Slc39a8 T A 3: 135,592,554 (GRCm39) probably null Het
Sppl2c C T 11: 104,078,141 (GRCm39) P314S probably benign Het
Tnni3k C T 3: 154,644,387 (GRCm39) probably null Het
Ugt1a1 AT A 1: 88,140,093 (GRCm39) probably null Het
Vmn2r68 A C 7: 84,882,834 (GRCm39) M306R probably benign Het
Vmn2r70 T A 7: 85,208,227 (GRCm39) Y750F probably damaging Het
Vwa7 G A 17: 35,240,218 (GRCm39) M395I probably damaging Het
Zfp53 A T 17: 21,728,340 (GRCm39) E124D probably benign Het
Other mutations in Eif4enif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01139:Eif4enif1 APN 11 3,171,143 (GRCm39) missense probably damaging 0.96
IGL02237:Eif4enif1 APN 11 3,177,876 (GRCm39) nonsense probably null
IGL02372:Eif4enif1 APN 11 3,179,986 (GRCm39) missense probably benign 0.09
PIT4283001:Eif4enif1 UTSW 11 3,184,464 (GRCm39) missense probably damaging 1.00
R0079:Eif4enif1 UTSW 11 3,192,676 (GRCm39) nonsense probably null
R1177:Eif4enif1 UTSW 11 3,179,902 (GRCm39) missense probably damaging 1.00
R1220:Eif4enif1 UTSW 11 3,189,493 (GRCm39) splice site probably benign
R1511:Eif4enif1 UTSW 11 3,186,278 (GRCm39) missense probably benign 0.00
R1675:Eif4enif1 UTSW 11 3,165,686 (GRCm39) missense probably benign 0.02
R1908:Eif4enif1 UTSW 11 3,177,455 (GRCm39) missense probably damaging 1.00
R1940:Eif4enif1 UTSW 11 3,193,279 (GRCm39) missense probably damaging 1.00
R2173:Eif4enif1 UTSW 11 3,192,367 (GRCm39) splice site probably null
R2215:Eif4enif1 UTSW 11 3,177,476 (GRCm39) missense probably damaging 1.00
R2517:Eif4enif1 UTSW 11 3,171,168 (GRCm39) missense probably damaging 1.00
R2869:Eif4enif1 UTSW 11 3,192,586 (GRCm39) missense probably damaging 1.00
R2869:Eif4enif1 UTSW 11 3,192,586 (GRCm39) missense probably damaging 1.00
R2870:Eif4enif1 UTSW 11 3,192,586 (GRCm39) missense probably damaging 1.00
R2870:Eif4enif1 UTSW 11 3,192,586 (GRCm39) missense probably damaging 1.00
R2871:Eif4enif1 UTSW 11 3,192,586 (GRCm39) missense probably damaging 1.00
R2873:Eif4enif1 UTSW 11 3,192,586 (GRCm39) missense probably damaging 1.00
R3147:Eif4enif1 UTSW 11 3,194,003 (GRCm39) splice site probably null
R4195:Eif4enif1 UTSW 11 3,193,186 (GRCm39) missense possibly damaging 0.89
R4196:Eif4enif1 UTSW 11 3,193,186 (GRCm39) missense possibly damaging 0.89
R4708:Eif4enif1 UTSW 11 3,170,323 (GRCm39) missense probably damaging 1.00
R4755:Eif4enif1 UTSW 11 3,194,016 (GRCm39) missense probably damaging 1.00
R5310:Eif4enif1 UTSW 11 3,192,687 (GRCm39) missense probably damaging 1.00
R5546:Eif4enif1 UTSW 11 3,193,989 (GRCm39) missense probably damaging 0.99
R5816:Eif4enif1 UTSW 11 3,192,401 (GRCm39) missense probably benign 0.13
R6018:Eif4enif1 UTSW 11 3,192,481 (GRCm39) missense probably damaging 0.97
R6036:Eif4enif1 UTSW 11 3,189,420 (GRCm39) missense probably damaging 1.00
R6036:Eif4enif1 UTSW 11 3,189,420 (GRCm39) missense probably damaging 1.00
R6267:Eif4enif1 UTSW 11 3,177,793 (GRCm39) missense probably damaging 1.00
R6514:Eif4enif1 UTSW 11 3,190,996 (GRCm39) missense probably null 0.01
R6638:Eif4enif1 UTSW 11 3,192,463 (GRCm39) missense probably damaging 0.96
R7040:Eif4enif1 UTSW 11 3,184,040 (GRCm39) missense probably benign 0.33
R7232:Eif4enif1 UTSW 11 3,165,678 (GRCm39) missense possibly damaging 0.75
R7385:Eif4enif1 UTSW 11 3,170,269 (GRCm39) missense probably damaging 1.00
R7478:Eif4enif1 UTSW 11 3,177,709 (GRCm39) nonsense probably null
R7749:Eif4enif1 UTSW 11 3,192,608 (GRCm39) missense probably damaging 0.99
R8381:Eif4enif1 UTSW 11 3,177,470 (GRCm39) missense probably damaging 1.00
R9029:Eif4enif1 UTSW 11 3,174,716 (GRCm39) missense probably damaging 1.00
R9622:Eif4enif1 UTSW 11 3,165,714 (GRCm39) missense probably benign 0.26
R9646:Eif4enif1 UTSW 11 3,170,280 (GRCm39) missense probably damaging 1.00
R9694:Eif4enif1 UTSW 11 3,170,384 (GRCm39) missense probably damaging 0.98
R9747:Eif4enif1 UTSW 11 3,163,267 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACCTGCTGTCATCCAATCC -3'
(R):5'- AAGTGAGACTGGATTGGACTCAC -3'

Sequencing Primer
(F):5'- CAATACTGATCAAGACTCTTCTACG -3'
(R):5'- GAGACTGGATTGGACTCACTACTTAG -3'
Posted On 2014-12-04