Mutagenetix > Incidental Mutations

Incidental Mutation 'R2516:Zfhx4'

253751

Institutional Source

Beutler Lab

Gene Symbol

Zfhx4

Ensembl Gene

ENSMUSG00000025255

Gene Name

zinc finger homeodomain 4

Synonyms

Zfh4, C130041O22Rik, Zfh-4

MMRRC Submission

040420-MU

Accession Numbers

Genbank: NM_030708; MGI: 2137668

Is this an essential gene?

Probably essential (E-score: 0.783) question?

Stock #

R2516 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

5218526-5415857 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 5403358 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 2859 (P2859S)

Ref Sequence

ENSEMBL: ENSMUSP00000135289 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026284] [ENSMUST00000175866] [ENSMUST00000176383]

Predicted Effect

probably benign
Transcript: ENSMUST00000026284
AA Change: P2859S

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000026284
Gene: ENSMUSG00000025255
AA Change: P2859S

Domain	Start	End	E-Value	Type
ZnF_C2H2	80	99	1.78e2	SMART
low complexity region	110	122	N/A	INTRINSIC
ZnF_C2H2	277	300	1.55e1	SMART
low complexity region	421	438	N/A	INTRINSIC
low complexity region	470	475	N/A	INTRINSIC
low complexity region	590	610	N/A	INTRINSIC
ZnF_C2H2	611	634	2.45e0	SMART
ZnF_C2H2	642	665	6.78e-3	SMART
ZnF_U1	694	728	1.8e-1	SMART
ZnF_C2H2	697	721	4.87e-4	SMART
low complexity region	754	763	N/A	INTRINSIC
ZnF_C2H2	765	789	6.67e-2	SMART
ZnF_C2H2	876	897	2.44e2	SMART
ZnF_U1	912	946	2.88e0	SMART
ZnF_C2H2	915	939	1.23e0	SMART
ZnF_C2H2	971	993	7.05e-1	SMART
ZnF_U1	1016	1050	3.73e0	SMART
ZnF_C2H2	1019	1043	4.98e-1	SMART
ZnF_C2H2	1188	1211	1.1e-2	SMART
ZnF_C2H2	1217	1240	4.94e0	SMART
ZnF_C2H2	1368	1390	7.67e-2	SMART
ZnF_C2H2	1396	1419	1.33e-1	SMART
ZnF_U1	1509	1543	7.4e-1	SMART
ZnF_C2H2	1512	1536	8.22e-2	SMART
ZnF_U1	1561	1595	3.73e0	SMART
ZnF_C2H2	1564	1588	1.16e-1	SMART
low complexity region	1664	1692	N/A	INTRINSIC
low complexity region	1701	1713	N/A	INTRINSIC
low complexity region	1762	1808	N/A	INTRINSIC
ZnF_C2H2	1916	1939	3.07e-1	SMART
low complexity region	1964	1990	N/A	INTRINSIC
low complexity region	2008	2032	N/A	INTRINSIC
low complexity region	2055	2072	N/A	INTRINSIC
HOX	2100	2162	4.23e-16	SMART
HOX	2197	2259	5.62e-21	SMART
ZnF_C2H2	2283	2303	1.13e1	SMART
low complexity region	2364	2376	N/A	INTRINSIC
low complexity region	2408	2425	N/A	INTRINSIC
low complexity region	2449	2460	N/A	INTRINSIC
ZnF_C2H2	2461	2483	2.17e-1	SMART
HOX	2573	2635	3.18e-20	SMART
ZnF_C2H2	2643	2666	6.67e-2	SMART
low complexity region	2874	2886	N/A	INTRINSIC
HOX	2896	2958	4.54e-16	SMART
ZnF_U1	2971	3005	6.59e-1	SMART
ZnF_C2H2	2974	2998	1.36e1	SMART
low complexity region	3066	3078	N/A	INTRINSIC
low complexity region	3106	3119	N/A	INTRINSIC
low complexity region	3163	3186	N/A	INTRINSIC
coiled coil region	3279	3308	N/A	INTRINSIC
ZnF_C2H2	3368	3388	1.12e2	SMART
ZnF_U1	3409	3443	6.16e-2	SMART
ZnF_C2H2	3412	3436	6.57e0	SMART
low complexity region	3461	3479	N/A	INTRINSIC
low complexity region	3505	3527	N/A	INTRINSIC
low complexity region	3536	3547	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000175866
AA Change: P2884S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000135827
Gene: ENSMUSG00000025255
AA Change: P2884S

Domain	Start	End	E-Value	Type
ZnF_C2H2	80	99	1.78e2	SMART
low complexity region	110	122	N/A	INTRINSIC
ZnF_C2H2	277	300	1.55e1	SMART
low complexity region	421	438	N/A	INTRINSIC
low complexity region	470	475	N/A	INTRINSIC
low complexity region	590	610	N/A	INTRINSIC
ZnF_C2H2	611	634	2.45e0	SMART
ZnF_C2H2	642	665	6.78e-3	SMART
ZnF_U1	694	728	1.8e-1	SMART
ZnF_C2H2	697	721	4.87e-4	SMART
low complexity region	754	763	N/A	INTRINSIC
ZnF_C2H2	765	789	6.67e-2	SMART
ZnF_C2H2	902	923	2.44e2	SMART
ZnF_U1	938	972	2.88e0	SMART
ZnF_C2H2	941	965	1.23e0	SMART
ZnF_C2H2	997	1019	7.05e-1	SMART
ZnF_U1	1042	1076	3.73e0	SMART
ZnF_C2H2	1045	1069	4.98e-1	SMART
ZnF_C2H2	1213	1236	1.1e-2	SMART
ZnF_C2H2	1242	1265	4.94e0	SMART
ZnF_C2H2	1393	1415	7.67e-2	SMART
ZnF_C2H2	1421	1444	1.33e-1	SMART
ZnF_U1	1534	1568	7.4e-1	SMART
ZnF_C2H2	1537	1561	8.22e-2	SMART
ZnF_U1	1586	1620	3.73e0	SMART
ZnF_C2H2	1589	1613	1.16e-1	SMART
low complexity region	1689	1717	N/A	INTRINSIC
low complexity region	1726	1738	N/A	INTRINSIC
low complexity region	1787	1833	N/A	INTRINSIC
ZnF_C2H2	1941	1964	3.07e-1	SMART
low complexity region	1989	2015	N/A	INTRINSIC
low complexity region	2033	2057	N/A	INTRINSIC
low complexity region	2080	2097	N/A	INTRINSIC
HOX	2125	2187	4.23e-16	SMART
HOX	2222	2284	5.62e-21	SMART
ZnF_C2H2	2308	2328	1.13e1	SMART
low complexity region	2389	2401	N/A	INTRINSIC
low complexity region	2433	2450	N/A	INTRINSIC
low complexity region	2474	2485	N/A	INTRINSIC
ZnF_C2H2	2486	2508	2.17e-1	SMART
HOX	2598	2660	3.18e-20	SMART
ZnF_C2H2	2668	2691	6.67e-2	SMART
low complexity region	2899	2911	N/A	INTRINSIC
HOX	2921	2983	4.54e-16	SMART
ZnF_U1	2996	3030	6.59e-1	SMART
ZnF_C2H2	2999	3023	1.36e1	SMART
low complexity region	3091	3103	N/A	INTRINSIC
low complexity region	3131	3144	N/A	INTRINSIC
low complexity region	3188	3211	N/A	INTRINSIC
coiled coil region	3304	3333	N/A	INTRINSIC
ZnF_C2H2	3393	3413	1.12e2	SMART
ZnF_U1	3434	3468	6.16e-2	SMART
ZnF_C2H2	3437	3461	6.57e0	SMART
low complexity region	3486	3504	N/A	INTRINSIC
low complexity region	3530	3552	N/A	INTRINSIC
low complexity region	3561	3572	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176383
AA Change: P2859S

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000135289
Gene: ENSMUSG00000025255
AA Change: P2859S

Domain	Start	End	E-Value	Type
ZnF_C2H2	80	99	1.78e2	SMART
low complexity region	110	122	N/A	INTRINSIC
ZnF_C2H2	277	300	1.55e1	SMART
low complexity region	421	438	N/A	INTRINSIC
low complexity region	470	475	N/A	INTRINSIC
low complexity region	590	610	N/A	INTRINSIC
ZnF_C2H2	611	634	2.45e0	SMART
ZnF_C2H2	642	665	6.78e-3	SMART
ZnF_U1	694	728	1.8e-1	SMART
ZnF_C2H2	697	721	4.87e-4	SMART
low complexity region	754	763	N/A	INTRINSIC
ZnF_C2H2	765	789	6.67e-2	SMART
ZnF_C2H2	876	897	2.44e2	SMART
ZnF_U1	912	946	2.88e0	SMART
ZnF_C2H2	915	939	1.23e0	SMART
ZnF_C2H2	971	993	7.05e-1	SMART
ZnF_U1	1016	1050	3.73e0	SMART
ZnF_C2H2	1019	1043	4.98e-1	SMART
ZnF_C2H2	1188	1211	1.1e-2	SMART
ZnF_C2H2	1217	1240	4.94e0	SMART
ZnF_C2H2	1368	1390	7.67e-2	SMART
ZnF_C2H2	1396	1419	1.33e-1	SMART
ZnF_U1	1509	1543	7.4e-1	SMART
ZnF_C2H2	1512	1536	8.22e-2	SMART
ZnF_U1	1561	1595	3.73e0	SMART
ZnF_C2H2	1564	1588	1.16e-1	SMART
low complexity region	1664	1692	N/A	INTRINSIC
low complexity region	1701	1713	N/A	INTRINSIC
low complexity region	1762	1808	N/A	INTRINSIC
ZnF_C2H2	1916	1939	3.07e-1	SMART
low complexity region	1964	1990	N/A	INTRINSIC
low complexity region	2008	2032	N/A	INTRINSIC
low complexity region	2055	2072	N/A	INTRINSIC
HOX	2100	2162	4.23e-16	SMART
HOX	2197	2259	5.62e-21	SMART
ZnF_C2H2	2283	2303	1.13e1	SMART
low complexity region	2364	2376	N/A	INTRINSIC
low complexity region	2408	2425	N/A	INTRINSIC
low complexity region	2449	2460	N/A	INTRINSIC
ZnF_C2H2	2461	2483	2.17e-1	SMART
HOX	2573	2635	3.18e-20	SMART
ZnF_C2H2	2643	2666	6.67e-2	SMART
low complexity region	2874	2886	N/A	INTRINSIC
HOX	2896	2958	4.54e-16	SMART
ZnF_U1	2971	3005	6.59e-1	SMART
ZnF_C2H2	2974	2998	1.36e1	SMART
low complexity region	3066	3078	N/A	INTRINSIC
low complexity region	3106	3119	N/A	INTRINSIC
low complexity region	3163	3186	N/A	INTRINSIC
coiled coil region	3279	3308	N/A	INTRINSIC
ZnF_C2H2	3368	3388	1.12e2	SMART
ZnF_U1	3409	3443	6.16e-2	SMART
ZnF_C2H2	3412	3436	6.57e0	SMART
low complexity region	3461	3479	N/A	INTRINSIC
low complexity region	3505	3527	N/A	INTRINSIC
low complexity region	3536	3547	N/A	INTRINSIC

Meta Mutation Damage Score

0.0583

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

98% (65/66)

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	A	T	2: 69,329,329	I6N	possibly damaging	Het
Aen	T	C	7: 78,905,868	V188A	probably damaging	Het
Afg3l1	A	G	8: 123,501,954	E753G	probably damaging	Het
Alas1	G	A	9: 106,238,660	T385I	probably damaging	Het
Alms1	C	A	6: 85,667,963		probably benign	Het
Ankrd65	A	G	4: 155,791,411	T30A	possibly damaging	Het
App	T	C	16: 84,978,229	S582G	probably damaging	Het
Arfgef1	A	T	1: 10,153,654	V1473E	possibly damaging	Het
Arhgap21	G	A	2: 20,854,998	P1196S	probably damaging	Het
Arhgap24	A	G	5: 102,891,910	T238A	probably benign	Het
Atf7	T	C	15: 102,529,004		probably benign	Het
Best1	G	T	19: 9,993,311	S55*	probably null	Het
Capn11	A	G	17: 45,633,799	V514A	probably damaging	Het
Cep104	T	A	4: 153,989,146	M52K	probably damaging	Het
Clca3a1	C	T	3: 144,737,858		probably null	Het
Cyp3a25	T	C	5: 146,003,027		probably null	Het
Dmxl2	G	A	9: 54,400,094	P2197S	probably damaging	Het
Drosha	T	C	15: 12,859,465		probably null	Het
Exosc9	A	G	3: 36,563,162	K355R	probably benign	Het
Fut1	A	C	7: 45,619,198	H192P	probably benign	Het
Gm572	T	A	4: 148,664,384	V166D	possibly damaging	Het
Gm9966	C	T	7: 95,958,528	P19S	unknown	Het
Gmds	C	T	13: 32,100,473	V219I	probably damaging	Het
Gsn	G	A	2: 35,283,953	E25K	probably benign	Het
Il4i1	T	C	7: 44,839,891	F368S	probably damaging	Het
Irak1bp1	T	C	9: 82,830,320	L98P	probably damaging	Het
Khdrbs3	T	C	15: 69,024,695		probably benign	Het
Kndc1	T	C	7: 139,921,822	I925T	probably damaging	Het
Laptm4a	T	C	12: 8,938,151	I296T	probably benign	Het
Lpl	A	T	8: 68,887,518	H55L	probably benign	Het
Lrrk2	C	A	15: 91,755,927	N1558K	probably benign	Het
Mfsd2a	A	G	4: 122,950,487	L289P	probably damaging	Het
Mmrn2	T	A	14: 34,398,802	M543K	probably benign	Het
Mnat1	T	C	12: 73,181,776		probably benign	Het
Msto1	A	T	3: 88,911,893		probably null	Het
Mtus1	A	G	8: 41,082,739	Y647H	probably damaging	Het
Nars	A	T	18: 64,505,016	V289E	probably damaging	Het
Oit3	T	A	10: 59,428,345	K322N	probably damaging	Het
Oit3	G	A	10: 59,441,685		probably benign	Het
Olfr1024	A	G	2: 85,904,556	I166T	probably benign	Het
Olfr1467	T	A	19: 13,365,193	C188*	probably null	Het
Olfr728	T	C	14: 50,139,983	I219V	probably benign	Het
Olfr801	G	A	10: 129,670,286	R78W	probably damaging	Het
Pecr	A	T	1: 72,277,310	C79S	probably damaging	Het
Plekhn1	T	C	4: 156,222,659	D478G	probably damaging	Het
Pls1	A	T	9: 95,776,563	M264K	probably benign	Het
Ptprj	C	A	2: 90,474,996		probably benign	Het
Pygm	A	G	19: 6,397,601	D646G	probably benign	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Scn8a	T	C	15: 100,969,162	V283A	probably benign	Het
Shisa5	T	C	9: 109,056,507		probably null	Het
Slc10a4	A	G	5: 73,008,505	I246V	possibly damaging	Het
Slc1a1	A	T	19: 28,892,912	I104F	probably benign	Het
Slc22a8	A	G	19: 8,610,195	Y511C	probably benign	Het
Slc6a5	A	G	7: 49,956,462	N706S	probably benign	Het
Sos2	T	C	12: 69,650,659	K96E	probably damaging	Het
Stom	G	A	2: 35,315,965	R251*	probably null	Het
Sycp1	T	C	3: 102,845,066	E800G	probably benign	Het
Tab2	G	A	10: 7,907,481	P679L	probably damaging	Het
Tiam2	G	A	17: 3,453,382	V945I	probably damaging	Het
Trpm5	G	T	7: 143,074,517	P1007Q	probably damaging	Het
Uchl1	T	G	5: 66,682,613	I139S	probably damaging	Het
Vmn1r232	A	G	17: 20,914,026	I104T	possibly damaging	Het
Vmn2r97	G	A	17: 18,947,552	M689I	probably benign	Het
Zc3h18	A	T	8: 122,403,165		probably benign	Het
Zfp456	T	C	13: 67,362,372	K99R	probably benign	Het

Other mutations in Zfhx4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Zfhx4	APN	3	5242341	missense	probably damaging	1.00
IGL00915:Zfhx4	APN	3	5245523	missense	probably damaging	0.99
IGL01145:Zfhx4	APN	3	5245347	missense	probably damaging	1.00
IGL01302:Zfhx4	APN	3	5243568	missense	probably damaging	1.00
IGL01314:Zfhx4	APN	3	5413094	missense	probably damaging	0.98
IGL01321:Zfhx4	APN	3	5242328	missense	probably benign	0.01
IGL01328:Zfhx4	APN	3	5244284	missense	probably damaging	1.00
IGL01333:Zfhx4	APN	3	5399327	missense	probably damaging	1.00
IGL01351:Zfhx4	APN	3	5401136	missense	probably damaging	1.00
IGL01524:Zfhx4	APN	3	5243976	missense	probably damaging	1.00
IGL01549:Zfhx4	APN	3	5399462	missense	probably damaging	1.00
IGL01715:Zfhx4	APN	3	5242045	missense	probably benign	0.00
IGL01736:Zfhx4	APN	3	5244092	missense	possibly damaging	0.85
IGL01904:Zfhx4	APN	3	5412709	missense	probably damaging	1.00
IGL02298:Zfhx4	APN	3	5244304	splice site	probably null
IGL02342:Zfhx4	APN	3	5402374	missense	probably benign	0.14
IGL02465:Zfhx4	APN	3	5399603	missense	possibly damaging	0.48
IGL02481:Zfhx4	APN	3	5411843	missense	probably damaging	0.99
IGL02511:Zfhx4	APN	3	5399183	missense	probably damaging	1.00
IGL02571:Zfhx4	APN	3	5329523	missense	probably damaging	1.00
IGL02685:Zfhx4	APN	3	5412153	missense	probably damaging	1.00
IGL02721:Zfhx4	APN	3	5243307	missense	possibly damaging	0.76
IGL02806:Zfhx4	APN	3	5390408	missense	probably benign	0.00
IGL03140:Zfhx4	APN	3	5242525	missense	probably damaging	1.00
IGL03185:Zfhx4	APN	3	5403914	missense	probably benign	0.05
IGL03209:Zfhx4	APN	3	5401171	missense	probably damaging	1.00
IGL03292:Zfhx4	APN	3	5411780	nonsense	probably null
IGL03302:Zfhx4	APN	3	5403713	missense	possibly damaging	0.88
IGL03303:Zfhx4	APN	3	5403350	missense	probably damaging	1.00
IGL03341:Zfhx4	APN	3	5411850	missense	probably damaging	0.98
3-1:Zfhx4	UTSW	3	5403385	missense	probably benign	0.14
B5639:Zfhx4	UTSW	3	5403175	missense	probably damaging	0.99
IGL02796:Zfhx4	UTSW	3	5399539	missense	probably damaging	1.00
IGL03047:Zfhx4	UTSW	3	5243733	missense	probably damaging	0.99
P0025:Zfhx4	UTSW	3	5399588	missense	probably benign	0.04
PIT4377001:Zfhx4	UTSW	3	5242742	missense	probably damaging	0.98
R0090:Zfhx4	UTSW	3	5243625	missense	probably damaging	1.00
R0107:Zfhx4	UTSW	3	5398982	missense	probably damaging	1.00
R0401:Zfhx4	UTSW	3	5401161	missense	possibly damaging	0.87
R0465:Zfhx4	UTSW	3	5245656	splice site	probably benign
R0506:Zfhx4	UTSW	3	5402735	missense	probably damaging	1.00
R0507:Zfhx4	UTSW	3	5400988	nonsense	probably null
R0550:Zfhx4	UTSW	3	5400494	missense	probably damaging	0.99
R0576:Zfhx4	UTSW	3	5402101	missense	probably damaging	1.00
R0590:Zfhx4	UTSW	3	5402633	missense	probably damaging	1.00
R0697:Zfhx4	UTSW	3	5401733	missense	probably damaging	0.99
R0727:Zfhx4	UTSW	3	5401073	missense	probably damaging	0.98
R0762:Zfhx4	UTSW	3	5403820	missense	probably damaging	1.00
R0815:Zfhx4	UTSW	3	5245315	missense	possibly damaging	0.87
R0863:Zfhx4	UTSW	3	5245315	missense	possibly damaging	0.87
R0866:Zfhx4	UTSW	3	5412212	missense	possibly damaging	0.58
R1109:Zfhx4	UTSW	3	5399870	missense	possibly damaging	0.59
R1177:Zfhx4	UTSW	3	5400831	small deletion	probably benign
R1338:Zfhx4	UTSW	3	5396961	missense	possibly damaging	0.86
R1388:Zfhx4	UTSW	3	5401387	missense	probably damaging	1.00
R1434:Zfhx4	UTSW	3	5241859	missense	probably benign	0.00
R1470:Zfhx4	UTSW	3	5413146	makesense	probably null
R1470:Zfhx4	UTSW	3	5413146	makesense	probably null
R1552:Zfhx4	UTSW	3	5403110	missense	probably damaging	1.00
R1589:Zfhx4	UTSW	3	5241729	missense	probably damaging	1.00
R1633:Zfhx4	UTSW	3	5400413	missense	probably damaging	1.00
R1656:Zfhx4	UTSW	3	5413016	missense	probably damaging	1.00
R1717:Zfhx4	UTSW	3	5403104	missense	probably benign	0.20
R1739:Zfhx4	UTSW	3	5401730	missense	probably damaging	1.00
R1760:Zfhx4	UTSW	3	5382616	missense	probably benign
R1842:Zfhx4	UTSW	3	5401498	missense	probably damaging	1.00
R1867:Zfhx4	UTSW	3	5412714	missense	probably damaging	1.00
R1868:Zfhx4	UTSW	3	5412714	missense	probably damaging	1.00
R2064:Zfhx4	UTSW	3	5398927	missense	probably damaging	1.00
R2083:Zfhx4	UTSW	3	5403163	missense	possibly damaging	0.58
R2154:Zfhx4	UTSW	3	5401741	missense	possibly damaging	0.86
R2165:Zfhx4	UTSW	3	5403358	missense	probably benign	0.32
R2181:Zfhx4	UTSW	3	5403332	missense	probably damaging	1.00
R2201:Zfhx4	UTSW	3	5242289	missense	probably damaging	1.00
R2209:Zfhx4	UTSW	3	5396918	missense	probably damaging	1.00
R2303:Zfhx4	UTSW	3	5397060	missense	probably damaging	0.99
R2327:Zfhx4	UTSW	3	5403358	missense	probably benign	0.32
R2420:Zfhx4	UTSW	3	5390405	missense	probably benign	0.00
R2422:Zfhx4	UTSW	3	5390405	missense	probably benign	0.00
R2518:Zfhx4	UTSW	3	5403358	missense	probably benign	0.32
R2519:Zfhx4	UTSW	3	5403358	missense	probably benign	0.32
R2520:Zfhx4	UTSW	3	5403358	missense	probably benign	0.32
R2566:Zfhx4	UTSW	3	5245143	missense	probably damaging	0.98
R2922:Zfhx4	UTSW	3	5403664	missense	probably damaging	1.00
R3000:Zfhx4	UTSW	3	5403654	missense	probably damaging	1.00
R3103:Zfhx4	UTSW	3	5399326	missense	probably damaging	1.00
R3409:Zfhx4	UTSW	3	5403358	missense	probably benign	0.32
R3414:Zfhx4	UTSW	3	5403823	missense	probably damaging	1.00
R3746:Zfhx4	UTSW	3	5243165	missense	possibly damaging	0.82
R3747:Zfhx4	UTSW	3	5243165	missense	possibly damaging	0.82
R3748:Zfhx4	UTSW	3	5243165	missense	possibly damaging	0.82
R3749:Zfhx4	UTSW	3	5243165	missense	possibly damaging	0.82
R3750:Zfhx4	UTSW	3	5243165	missense	possibly damaging	0.82
R3763:Zfhx4	UTSW	3	5403344	missense	probably damaging	1.00
R3826:Zfhx4	UTSW	3	5401209	missense	probably damaging	1.00
R3827:Zfhx4	UTSW	3	5401209	missense	probably damaging	1.00
R3830:Zfhx4	UTSW	3	5401209	missense	probably damaging	1.00
R3877:Zfhx4	UTSW	3	5400785	missense	probably benign
R3919:Zfhx4	UTSW	3	5399115	missense	possibly damaging	0.48
R3922:Zfhx4	UTSW	3	5400647	missense	probably damaging	1.00
R3927:Zfhx4	UTSW	3	5403358	missense	probably benign	0.32
R3965:Zfhx4	UTSW	3	5403847	missense	probably damaging	1.00
R4004:Zfhx4	UTSW	3	5403358	missense	probably benign	0.32
R4049:Zfhx4	UTSW	3	5398859	missense	probably damaging	1.00
R4073:Zfhx4	UTSW	3	5399324	missense	probably damaging	1.00
R4134:Zfhx4	UTSW	3	5243627	missense	probably damaging	1.00
R4401:Zfhx4	UTSW	3	5403345	nonsense	probably null
R4439:Zfhx4	UTSW	3	5214815	unclassified	probably benign
R4497:Zfhx4	UTSW	3	5399620	missense	possibly damaging	0.88
R4518:Zfhx4	UTSW	3	5412518	missense	probably damaging	1.00
R4569:Zfhx4	UTSW	3	5401834	missense	probably benign	0.00
R4612:Zfhx4	UTSW	3	5397063	missense	probably damaging	1.00
R4616:Zfhx4	UTSW	3	5413067	missense	possibly damaging	0.66
R4626:Zfhx4	UTSW	3	5402639	missense	probably damaging	1.00
R4628:Zfhx4	UTSW	3	5403476	missense	probably damaging	1.00
R4637:Zfhx4	UTSW	3	5403404	missense	probably damaging	1.00
R4647:Zfhx4	UTSW	3	5399281	missense	probably damaging	0.99
R4708:Zfhx4	UTSW	3	5245503	splice site	probably null
R4729:Zfhx4	UTSW	3	5399497	missense	probably damaging	1.00
R4732:Zfhx4	UTSW	3	5214807	unclassified	probably benign
R4757:Zfhx4	UTSW	3	5400062	missense	possibly damaging	0.85
R4765:Zfhx4	UTSW	3	5400152	missense	probably benign
R4819:Zfhx4	UTSW	3	5403914	missense	probably benign	0.05
R4937:Zfhx4	UTSW	3	5242011	missense	probably damaging	1.00
R4980:Zfhx4	UTSW	3	5398979	missense	possibly damaging	0.47
R5124:Zfhx4	UTSW	3	5242047	missense	probably damaging	1.00
R5214:Zfhx4	UTSW	3	5403641	missense	probably damaging	1.00
R5361:Zfhx4	UTSW	3	5399207	missense	probably damaging	0.99
R5375:Zfhx4	UTSW	3	5412425	missense	probably damaging	0.99
R5485:Zfhx4	UTSW	3	5243007	missense	probably damaging	1.00
R5588:Zfhx4	UTSW	3	5403138	missense	probably damaging	1.00
R5609:Zfhx4	UTSW	3	5403619	missense	probably damaging	1.00
R5726:Zfhx4	UTSW	3	5403321	missense	probably benign	0.02
R5758:Zfhx4	UTSW	3	5402620	missense	probably damaging	1.00
R5865:Zfhx4	UTSW	3	5402659	missense	probably damaging	1.00
R5938:Zfhx4	UTSW	3	5402138	missense	probably damaging	0.99
R5952:Zfhx4	UTSW	3	5396970	missense	probably damaging	0.99
R6043:Zfhx4	UTSW	3	5403427	missense	probably benign	0.00
R6045:Zfhx4	UTSW	3	5396959	missense	probably damaging	1.00
R6125:Zfhx4	UTSW	3	5398811	missense	possibly damaging	0.68
R6354:Zfhx4	UTSW	3	5401951	missense	probably benign
R6374:Zfhx4	UTSW	3	5244035	missense	probably damaging	1.00
R6378:Zfhx4	UTSW	3	5243350	missense	probably benign	0.07
R6380:Zfhx4	UTSW	3	5413110	missense	probably damaging	0.99
R6413:Zfhx4	UTSW	3	5243145	missense	probably damaging	1.00
R6449:Zfhx4	UTSW	3	5242428	missense	probably damaging	1.00
R6539:Zfhx4	UTSW	3	5244108	missense	probably damaging	0.99
R6714:Zfhx4	UTSW	3	5241837	missense	probably damaging	1.00
R6933:Zfhx4	UTSW	3	5412987	missense	probably damaging	0.99
R6982:Zfhx4	UTSW	3	5403830	missense	probably damaging	1.00
R7104:Zfhx4	UTSW	3	5402489	missense	probably damaging	0.97
R7127:Zfhx4	UTSW	3	5413044	missense	probably damaging	0.99
R7138:Zfhx4	UTSW	3	5412047	missense	possibly damaging	0.69
R7161:Zfhx4	UTSW	3	5244083	missense	possibly damaging	0.65
R7213:Zfhx4	UTSW	3	5396644	missense	probably benign
R7483:Zfhx4	UTSW	3	5412177	missense	probably damaging	0.98
R7514:Zfhx4	UTSW	3	5242207	missense	possibly damaging	0.91
R7544:Zfhx4	UTSW	3	5412815	missense	probably damaging	0.98
R7565:Zfhx4	UTSW	3	5390366	missense	probably benign	0.04
R7611:Zfhx4	UTSW	3	5403771	missense	probably damaging	1.00
R7640:Zfhx4	UTSW	3	5412480	missense	probably benign	0.19
R7649:Zfhx4	UTSW	3	5242110	missense	probably damaging	1.00
R7689:Zfhx4	UTSW	3	5411886	missense	probably benign	0.05
R7711:Zfhx4	UTSW	3	5396956	missense	probably damaging	0.98
R7895:Zfhx4	UTSW	3	5242199	missense	probably benign	0.00
R7920:Zfhx4	UTSW	3	5400455	missense	possibly damaging	0.62
R7972:Zfhx4	UTSW	3	5412473	missense	probably benign	0.02
R7993:Zfhx4	UTSW	3	5412987	missense	probably damaging	1.00
R8133:Zfhx4	UTSW	3	5400494	missense	probably damaging	0.99
R8158:Zfhx4	UTSW	3	5398950	nonsense	probably null
R8272:Zfhx4	UTSW	3	5243867	missense	probably damaging	0.99
R8285:Zfhx4	UTSW	3	5401856	missense	probably benign	0.17
R8321:Zfhx4	UTSW	3	5401127	missense	probably damaging	1.00
R8381:Zfhx4	UTSW	3	5382616	missense	probably benign	0.00
R8434:Zfhx4	UTSW	3	5398858	missense	probably damaging	0.99
R8466:Zfhx4	UTSW	3	5242702	missense	probably damaging	1.00
R8515:Zfhx4	UTSW	3	5399474	missense	probably benign	0.00
R8525:Zfhx4	UTSW	3	5399543	missense	probably damaging	1.00
RF019:Zfhx4	UTSW	3	5403267	missense	probably benign	0.08
X0025:Zfhx4	UTSW	3	5411836	missense	probably damaging	0.99
X0026:Zfhx4	UTSW	3	5412338	missense	probably benign	0.00
X0028:Zfhx4	UTSW	3	5402414	missense	probably benign	0.13
X0028:Zfhx4	UTSW	3	5403267	missense	probably damaging	1.00
X0054:Zfhx4	UTSW	3	5399710	nonsense	probably null
Z1177:Zfhx4	UTSW	3	5242446	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTGAAACCAGCTTTGTCCCC -3'
(R):5'- AGACCAATCTCATTGCCCAG -3'

Sequencing Primer
(F):5'- GTGAAACCAGCTTTGTCCCCTAAAG -3'
(R):5'- CGATAGTCACTGAAGCAAGCCTTG -3'

Posted On

2014-12-04