Incidental Mutation 'R2871:Pes1'
ID253752
Institutional Source Beutler Lab
Gene Symbol Pes1
Ensembl Gene ENSMUSG00000020430
Gene Namepescadillo ribosomal biogenesis factor 1
Synonyms
MMRRC Submission 040459-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2871 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location3963975-3980004 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 3976834 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 372 (T372K)
Ref Sequence ENSEMBL: ENSMUSP00000105612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020705] [ENSMUST00000042344] [ENSMUST00000109985]
Predicted Effect probably benign
Transcript: ENSMUST00000020705
AA Change: T368K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000020705
Gene: ENSMUSG00000020430
AA Change: T368K

DomainStartEndE-ValueType
Pfam:Pescadillo_N 6 286 5.1e-135 PFAM
BRCT 323 404 4.81e-7 SMART
coiled coil region 469 542 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000042344
SMART Domains Protein: ENSMUSP00000048953
Gene: ENSMUSG00000034493

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
low complexity region 84 93 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109985
AA Change: T372K

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000105612
Gene: ENSMUSG00000020430
AA Change: T372K

DomainStartEndE-ValueType
Pfam:Pescadillo_N 7 284 1.1e-130 PFAM
BRCT 327 408 4.81e-7 SMART
coiled coil region 473 546 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137544
Meta Mutation Damage Score 0.0986 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.2%
  • 10x: 92.4%
  • 20x: 72.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that contains a breast cancer associated gene 1 (BRCA1) C-terminal interaction domain. The encoded protein interacts with BOP1 and WDR12 to form the PeBoW complex, which plays a critical role in cell proliferation via pre-rRNA processing and 60S ribosomal subunit maturation. Expression of this gene may play an important role in breast cancer proliferation and tumorigenicity. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. Pseudogenes of this gene are located on the long arm of chromosome 4 and the short arm of chromosome 9. [provided by RefSeq, Aug 2011]
PHENOTYPE: Targeted disuption of the mouse gene results in embryonic arrest at morula stages of development, as well as failure of nucleologenesis and disruption of ribosome biogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,955,176 C811R possibly damaging Het
AI481877 A C 4: 59,093,850 L226R probably damaging Het
Akap8l G A 17: 32,338,442 T65I possibly damaging Het
Arid4a T A 12: 71,022,260 probably null Het
Armc2 C T 10: 41,966,700 probably null Het
Atp6v1g1 A G 4: 63,550,021 Y87C probably benign Het
Cfap54 A T 10: 92,921,419 F273I possibly damaging Het
Clasrp C A 7: 19,585,240 probably benign Het
Csmd2 T C 4: 128,557,718 F113S unknown Het
Cyp4a14 C A 4: 115,487,301 G456W probably damaging Het
Cyp4a30b A G 4: 115,458,362 H260R possibly damaging Het
Ddrgk1 T A 2: 130,664,644 probably benign Het
Dhx57 A T 17: 80,251,376 D1051E probably benign Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Eif4enif1 C T 11: 3,242,586 P805S probably damaging Het
Eml5 C T 12: 98,865,401 D433N probably damaging Het
Fan1 A G 7: 64,363,190 I668T probably benign Het
Frmpd4 A T X: 167,477,247 D1166E probably benign Het
Gm813 A T 16: 58,613,979 I125K probably benign Het
Gria2 G A 3: 80,702,492 T670I probably damaging Het
Grid2ip C A 5: 143,357,929 Q127K probably benign Het
Hdhd2 T C 18: 76,955,006 F44L probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hmcn1 A T 1: 150,738,716 V1313D possibly damaging Het
Ift172 C T 5: 31,257,861 V1335I probably benign Het
Ighv2-2 G A 12: 113,588,498 T40I possibly damaging Het
Kcnk10 T A 12: 98,434,813 R520S probably benign Het
Kif1c A G 11: 70,724,081 E567G probably damaging Het
Klf8 A T X: 153,382,682 E82D probably damaging Het
Kpna7 T C 5: 144,993,935 T367A probably benign Het
Lpo A G 11: 87,816,524 I221T possibly damaging Het
Lrrn3 T C 12: 41,452,723 I532V probably benign Het
Matr3 T A 18: 35,572,296 S91R probably benign Het
Mki67 G A 7: 135,708,149 P191L probably benign Het
Mlxip A G 5: 123,452,667 M878V probably benign Het
Mpp7 G A 18: 7,461,678 P65L possibly damaging Het
Mroh2a C A 1: 88,255,565 L1292I probably damaging Het
Msh2 C A 17: 87,685,584 Q314K possibly damaging Het
Mtor T A 4: 148,540,030 M2089K probably benign Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nlrp4b C T 7: 10,710,243 Q40* probably null Het
Nomo1 C A 7: 46,046,937 T293N probably damaging Het
Notum A G 11: 120,660,196 V48A probably benign Het
Npas3 C T 12: 54,068,013 R542* probably null Het
Olfr1101 A T 2: 86,988,848 C109* probably null Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Olfr45 A G 7: 140,691,285 I127V possibly damaging Het
Olfr71 C A 4: 43,706,458 V37L probably benign Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Pcdhga9 T A 18: 37,737,471 Y118N possibly damaging Het
Pkp4 C A 2: 59,308,156 T250K probably benign Het
Plekhg5 T A 4: 152,107,503 C433S probably benign Het
Plin2 A G 4: 86,668,678 M1T probably null Het
Prdx4 A G X: 155,340,464 V15A probably benign Het
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Psmd13 A T 7: 140,887,055 T116S probably damaging Het
Rel T C 11: 23,761,129 I13V probably benign Het
Reln C T 5: 22,049,791 V527I possibly damaging Het
Rnf6 T C 5: 146,210,405 Y601C probably benign Het
Rps6kc1 T C 1: 190,899,569 I48M probably damaging Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Slc39a8 T A 3: 135,886,793 probably null Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
St5 A T 7: 109,557,430 Y38N probably benign Het
Tnni3k C T 3: 154,938,750 probably null Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vmn2r70 T A 7: 85,559,019 Y750F probably damaging Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Other mutations in Pes1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Pes1 APN 11 3976803 missense probably damaging 1.00
IGL01448:Pes1 APN 11 3977979 missense possibly damaging 0.89
H8441:Pes1 UTSW 11 3977636 small deletion probably benign
R0634:Pes1 UTSW 11 3977794 splice site probably benign
R0634:Pes1 UTSW 11 3977795 splice site probably benign
R0883:Pes1 UTSW 11 3975557 missense probably damaging 1.00
R0980:Pes1 UTSW 11 3977636 small deletion probably benign
R1435:Pes1 UTSW 11 3976075 missense probably benign 0.00
R1557:Pes1 UTSW 11 3976824 missense probably damaging 1.00
R1694:Pes1 UTSW 11 3977719 small deletion probably benign
R1885:Pes1 UTSW 11 3969482 missense probably damaging 1.00
R1929:Pes1 UTSW 11 3969524 missense probably damaging 1.00
R2270:Pes1 UTSW 11 3969524 missense probably damaging 1.00
R2272:Pes1 UTSW 11 3969524 missense probably damaging 1.00
R2362:Pes1 UTSW 11 3977123 missense probably damaging 1.00
R2869:Pes1 UTSW 11 3976834 missense probably benign 0.05
R2869:Pes1 UTSW 11 3976834 missense probably benign 0.05
R2870:Pes1 UTSW 11 3976834 missense probably benign 0.05
R2870:Pes1 UTSW 11 3976834 missense probably benign 0.05
R2871:Pes1 UTSW 11 3976834 missense probably benign 0.05
R2873:Pes1 UTSW 11 3976834 missense probably benign 0.05
R3024:Pes1 UTSW 11 3977719 small deletion probably benign
R3039:Pes1 UTSW 11 3975547 missense probably damaging 1.00
R3195:Pes1 UTSW 11 3975736 splice site probably benign
R3773:Pes1 UTSW 11 3975548 missense probably damaging 1.00
R4590:Pes1 UTSW 11 3977986 missense probably damaging 1.00
R4739:Pes1 UTSW 11 3964058 missense probably damaging 1.00
R5396:Pes1 UTSW 11 3977719 small deletion probably benign
R6016:Pes1 UTSW 11 3978004 missense possibly damaging 0.68
R6351:Pes1 UTSW 11 3978865 missense probably benign
R6921:Pes1 UTSW 11 3973330 missense probably damaging 0.98
R7315:Pes1 UTSW 11 3976085 missense probably benign 0.00
R8178:Pes1 UTSW 11 3977718 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGAGTGTAGTTGTTATCCCAGAC -3'
(R):5'- CATAGTACCTGGTGCAGAGCAG -3'

Sequencing Primer
(F):5'- GTTGTTATCCCAGACAGAAGACTC -3'
(R):5'- TGCAGAGCAGCCAAAGAAATGTC -3'
Posted On2014-12-04