Mutagenetix > Incidental Mutation

Incidental Mutation 'R2871:Rel'

253754

Institutional Source

Beutler Lab

Gene Symbol

Rel

Ensembl Gene

ENSMUSG00000020275

Gene Name

reticuloendotheliosis oncogene

Synonyms

c-Rel

MMRRC Submission

040459-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2871 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

23736847-23770970 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 23761129 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 13 (I13V)

Ref Sequence

ENSEMBL: ENSMUSP00000099928 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102864]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000102864
AA Change: I13V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000099928
Gene: ENSMUSG00000020275
AA Change: I13V

Domain	Start	End	E-Value	Type
Pfam:RHD_DNA_bind	10	178	8.1e-78	PFAM
IPT	185	280	7.64e-24	SMART
low complexity region	512	530	N/A	INTRINSIC

Meta Mutation Damage Score

0.0583

Coding Region Coverage

1x: 99.5%
3x: 98.2%
10x: 92.4%
20x: 72.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Rel homology domain/immunoglobulin-like fold, plexin, transcription factor (RHD/IPT) family. Members of this family regulate genes involved in apoptosis, inflammation, the immune response, and oncogenic processes. This proto-oncogene plays a role in the survival and proliferation of B lymphocytes. Mutation or amplification of this gene is associated with B-cell lymphomas, including Hodgkin's lymphoma. Single nucleotide polymorphisms in this gene are associated with susceptibility to ulcerative colitis and rheumatoid arthritis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygous inactivation of this gene causes defects in lymphocyte proliferation, humoral immunity and cytokine production, and may lead to impaired Th1 responses and resistance to autoimmune disease. Mice lacking only the COOH-terminal region show severehemopoietic defects and lymphoid hyperplasia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	A	G	11: 109,955,176	C811R	possibly damaging	Het
AI481877	A	C	4: 59,093,850	L226R	probably damaging	Het
Akap8l	G	A	17: 32,338,442	T65I	possibly damaging	Het
Arid4a	T	A	12: 71,022,260		probably null	Het
Armc2	C	T	10: 41,966,700		probably null	Het
Atp6v1g1	A	G	4: 63,550,021	Y87C	probably benign	Het
Cfap54	A	T	10: 92,921,419	F273I	possibly damaging	Het
Clasrp	C	A	7: 19,585,240		probably benign	Het
Csmd2	T	C	4: 128,557,718	F113S	unknown	Het
Cyp4a14	C	A	4: 115,487,301	G456W	probably damaging	Het
Cyp4a30b	A	G	4: 115,458,362	H260R	possibly damaging	Het
Ddrgk1	T	A	2: 130,664,644		probably benign	Het
Dhx57	A	T	17: 80,251,376	D1051E	probably benign	Het
Eef2	GCCC	GCCCC	10: 81,178,767		probably null	Het
Eif4enif1	C	T	11: 3,242,586	P805S	probably damaging	Het
Eml5	C	T	12: 98,865,401	D433N	probably damaging	Het
Fan1	A	G	7: 64,363,190	I668T	probably benign	Het
Frmpd4	A	T	X: 167,477,247	D1166E	probably benign	Het
Gm813	A	T	16: 58,613,979	I125K	probably benign	Het
Gria2	G	A	3: 80,702,492	T670I	probably damaging	Het
Grid2ip	C	A	5: 143,357,929	Q127K	probably benign	Het
Hdhd2	T	C	18: 76,955,006	F44L	probably damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hmcn1	A	T	1: 150,738,716	V1313D	possibly damaging	Het
Ift172	C	T	5: 31,257,861	V1335I	probably benign	Het
Ighv2-2	G	A	12: 113,588,498	T40I	possibly damaging	Het
Kcnk10	T	A	12: 98,434,813	R520S	probably benign	Het
Kif1c	A	G	11: 70,724,081	E567G	probably damaging	Het
Klf8	A	T	X: 153,382,682	E82D	probably damaging	Het
Kpna7	T	C	5: 144,993,935	T367A	probably benign	Het
Lpo	A	G	11: 87,816,524	I221T	possibly damaging	Het
Lrrn3	T	C	12: 41,452,723	I532V	probably benign	Het
Matr3	T	A	18: 35,572,296	S91R	probably benign	Het
Mki67	G	A	7: 135,708,149	P191L	probably benign	Het
Mlxip	A	G	5: 123,452,667	M878V	probably benign	Het
Mpp7	G	A	18: 7,461,678	P65L	possibly damaging	Het
Mroh2a	C	A	1: 88,255,565	L1292I	probably damaging	Het
Msh2	C	A	17: 87,685,584	Q314K	possibly damaging	Het
Mtor	T	A	4: 148,540,030	M2089K	probably benign	Het
Myo9b	G	A	8: 71,334,337	R721Q	probably benign	Het
Nlrp4b	C	T	7: 10,710,243	Q40*	probably null	Het
Nomo1	C	A	7: 46,046,937	T293N	probably damaging	Het
Notum	A	G	11: 120,660,196	V48A	probably benign	Het
Npas3	C	T	12: 54,068,013	R542*	probably null	Het
Olfr1101	A	T	2: 86,988,848	C109*	probably null	Het
Olfr419	T	C	1: 174,250,526	S134G	probably benign	Het
Olfr45	A	G	7: 140,691,285	I127V	possibly damaging	Het
Olfr71	C	A	4: 43,706,458	V37L	probably benign	Het
Ostc	T	C	3: 130,703,508	N80S	probably damaging	Het
Palmd	T	C	3: 116,923,751	R366G	possibly damaging	Het
Parp1	A	G	1: 180,573,665	D45G	probably damaging	Het
Pcdhga9	T	A	18: 37,737,471	Y118N	possibly damaging	Het
Pes1	C	A	11: 3,976,834	T372K	probably benign	Het
Pkp4	C	A	2: 59,308,156	T250K	probably benign	Het
Plekhg5	T	A	4: 152,107,503	C433S	probably benign	Het
Plin2	A	G	4: 86,668,678	M1T	probably null	Het
Prdx4	A	G	X: 155,340,464	V15A	probably benign	Het
Psmb8	T	C	17: 34,200,170	I146T	probably damaging	Het
Psmd13	A	T	7: 140,887,055	T116S	probably damaging	Het
Reln	C	T	5: 22,049,791	V527I	possibly damaging	Het
Rnf6	T	C	5: 146,210,405	Y601C	probably benign	Het
Rps6kc1	T	C	1: 190,899,569	I48M	probably damaging	Het
Sfi1	CCTCTC	CCTCTCTC	11: 3,177,419		probably benign	Het
Slc39a8	T	A	3: 135,886,793		probably null	Het
Sppl2c	C	T	11: 104,187,315	P314S	probably benign	Het
St5	A	T	7: 109,557,430	Y38N	probably benign	Het
Tnni3k	C	T	3: 154,938,750		probably null	Het
Ugt1a1	AT	A	1: 88,212,371		probably null	Het
Vmn2r68	A	C	7: 85,233,626	M306R	probably benign	Het
Vmn2r70	T	A	7: 85,559,019	Y750F	probably damaging	Het
Vwa7	G	A	17: 35,021,242	M395I	probably damaging	Het
Zfp53	A	T	17: 21,508,078	E124D	probably benign	Het

Other mutations in Rel

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00663:Rel	APN	11	23757043	missense	probably benign	0.31
IGL00819:Rel	APN	11	23743029	missense	probably benign	0.13
IGL00906:Rel	APN	11	23744266	missense	probably benign	0.00
IGL01358:Rel	APN	11	23761155	missense	probably benign	0.06
IGL01820:Rel	APN	11	23753218	missense	probably benign	0.22
IGL01889:Rel	APN	11	23757035	missense	probably damaging	0.96
IGL03270:Rel	APN	11	23742584	missense	probably benign	0.16
Amun-ra	UTSW	11	23757026	nonsense	probably null
Fleur	UTSW	11		unclassified
giza	UTSW	11	23757010	missense	probably damaging	1.00
Horus	UTSW	11	23753215	critical splice donor site	probably null
osirus	UTSW	11	23742713	missense	probably benign	0.00
Seth	UTSW	11	23748855	missense	probably damaging	1.00
R0766:Rel	UTSW	11	23757010	missense	probably damaging	1.00
R0924:Rel	UTSW	11	23742439	missense	probably benign	0.02
R0930:Rel	UTSW	11	23742439	missense	probably benign	0.02
R1312:Rel	UTSW	11	23757010	missense	probably damaging	1.00
R1339:Rel	UTSW	11	23745763	missense	probably damaging	1.00
R1584:Rel	UTSW	11	23745546	missense	probably damaging	1.00
R1980:Rel	UTSW	11	23742761	missense	probably benign
R1981:Rel	UTSW	11	23742761	missense	probably benign
R1982:Rel	UTSW	11	23742761	missense	probably benign
R2513:Rel	UTSW	11	23745823	missense	probably damaging	1.00
R2870:Rel	UTSW	11	23761129	missense	probably benign
R2870:Rel	UTSW	11	23761129	missense	probably benign
R2871:Rel	UTSW	11	23761129	missense	probably benign
R2872:Rel	UTSW	11	23761129	missense	probably benign
R2872:Rel	UTSW	11	23761129	missense	probably benign
R3617:Rel	UTSW	11	23745780	missense	probably damaging	1.00
R3976:Rel	UTSW	11	23742939	missense	probably benign	0.07
R4010:Rel	UTSW	11	23761138	missense	probably benign
R4067:Rel	UTSW	11	23753215	critical splice donor site	probably null
R5345:Rel	UTSW	11	23742462	missense	probably benign	0.00
R5866:Rel	UTSW	11	23742724	nonsense	probably null
R6032:Rel	UTSW	11	23742684	missense	probably benign	0.02
R6032:Rel	UTSW	11	23742684	missense	probably benign	0.02
R6562:Rel	UTSW	11	23757026	nonsense	probably null
R6886:Rel	UTSW	11	23744304	missense	probably benign	0.03
R7516:Rel	UTSW	11	23742785	missense	probably benign	0.00
R7522:Rel	UTSW	11	23770676	splice site	probably null
R7663:Rel	UTSW	11	23742713	missense	probably benign	0.00
R7873:Rel	UTSW	11	23742957	missense	probably benign	0.00
R7960:Rel	UTSW	11	23744493	missense	probably damaging	0.98
R8679:Rel	UTSW	11	23742430	missense	probably benign
R8819:Rel	UTSW	11	23745626	missense	probably damaging	1.00
R9001:Rel	UTSW	11	23748855	missense	probably damaging	1.00
R9215:Rel	UTSW	11	23748870	missense	probably benign	0.00
Z1176:Rel	UTSW	11	23745472	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGGGTTGCAAAAGACTGTTAAACTG -3'
(R):5'- CCCTCATGTGGACAGGTAAC -3'

Sequencing Primer
(F):5'- AAACTGAGTCTTCTGCCAGG -3'
(R):5'- GCAATAAAGAACTCACCAGTTATGTG -3'

Posted On

2014-12-04