Incidental Mutation 'R2871:Kif1c'
ID 253756
Institutional Source Beutler Lab
Gene Symbol Kif1c
Ensembl Gene ENSMUSG00000020821
Gene Name kinesin family member 1C
Synonyms N-3 kinsin, B430105J22Rik, D11Bwg1349e, Orch3
MMRRC Submission 040459-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2871 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 70591374-70622790 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 70614907 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 567 (E567G)
Ref Sequence ENSEMBL: ENSMUSP00000123242 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072187] [ENSMUST00000094499] [ENSMUST00000102554] [ENSMUST00000137119]
AlphaFold O35071
Predicted Effect possibly damaging
Transcript: ENSMUST00000072187
AA Change: E567G

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000072048
Gene: ENSMUSG00000020821
AA Change: E567G

DomainStartEndE-ValueType
KISc 3 356 6.18e-175 SMART
low complexity region 402 418 N/A INTRINSIC
FHA 522 575 1.45e-2 SMART
low complexity region 607 622 N/A INTRINSIC
coiled coil region 634 673 N/A INTRINSIC
coiled coil region 842 883 N/A INTRINSIC
low complexity region 955 975 N/A INTRINSIC
low complexity region 1009 1055 N/A INTRINSIC
low complexity region 1072 1100 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000094499
AA Change: E567G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000092075
Gene: ENSMUSG00000020821
AA Change: E567G

DomainStartEndE-ValueType
KISc 3 356 6.18e-175 SMART
low complexity region 402 418 N/A INTRINSIC
FHA 522 575 1.45e-2 SMART
low complexity region 607 622 N/A INTRINSIC
coiled coil region 634 671 N/A INTRINSIC
coiled coil region 830 871 N/A INTRINSIC
low complexity region 943 963 N/A INTRINSIC
low complexity region 997 1043 N/A INTRINSIC
low complexity region 1060 1088 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102554
AA Change: E567G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099614
Gene: ENSMUSG00000020821
AA Change: E567G

DomainStartEndE-ValueType
KISc 3 356 6.18e-175 SMART
low complexity region 402 418 N/A INTRINSIC
FHA 522 575 1.45e-2 SMART
low complexity region 607 622 N/A INTRINSIC
coiled coil region 634 671 N/A INTRINSIC
coiled coil region 830 871 N/A INTRINSIC
low complexity region 943 963 N/A INTRINSIC
low complexity region 997 1043 N/A INTRINSIC
low complexity region 1060 1088 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000137119
AA Change: E567G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123242
Gene: ENSMUSG00000020821
AA Change: E567G

DomainStartEndE-ValueType
KISc 3 356 6.18e-175 SMART
low complexity region 402 418 N/A INTRINSIC
FHA 522 575 1.45e-2 SMART
low complexity region 607 622 N/A INTRINSIC
coiled coil region 634 671 N/A INTRINSIC
coiled coil region 830 871 N/A INTRINSIC
low complexity region 943 963 N/A INTRINSIC
low complexity region 997 1043 N/A INTRINSIC
low complexity region 1060 1088 N/A INTRINSIC
Meta Mutation Damage Score 0.4007 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.2%
  • 10x: 92.4%
  • 20x: 72.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the kinesin-like protein family. The family members are microtubule-dependent molecular motors that transport organelles within cells and move chromosomes during cell division. Mutations in this gene are a cause of spastic ataxia 2, autosomal recessive. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a reporter allele are viable, fertile and overtly normal and display normal motor-dependent retrograde Golgi apparatus-to-endoplasmic reticulum transport. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,846,002 (GRCm39) C811R possibly damaging Het
Akap8l G A 17: 32,557,416 (GRCm39) T65I possibly damaging Het
Arid4a T A 12: 71,069,034 (GRCm39) probably null Het
Armc2 C T 10: 41,842,696 (GRCm39) probably null Het
Atp6v1g1 A G 4: 63,468,258 (GRCm39) Y87C probably benign Het
Cfap54 A T 10: 92,757,281 (GRCm39) F273I possibly damaging Het
Clasrp C A 7: 19,319,165 (GRCm39) probably benign Het
Csmd2 T C 4: 128,451,511 (GRCm39) F113S unknown Het
Cyp4a14 C A 4: 115,344,498 (GRCm39) G456W probably damaging Het
Cyp4a30b A G 4: 115,315,559 (GRCm39) H260R possibly damaging Het
Ddrgk1 T A 2: 130,506,564 (GRCm39) probably benign Het
Dennd2b A T 7: 109,156,637 (GRCm39) Y38N probably benign Het
Dhx57 A T 17: 80,558,805 (GRCm39) D1051E probably benign Het
Eef2 GCCC GCCCC 10: 81,014,601 (GRCm39) probably null Het
Eif4enif1 C T 11: 3,192,586 (GRCm39) P805S probably damaging Het
Eml5 C T 12: 98,831,660 (GRCm39) D433N probably damaging Het
Fan1 A G 7: 64,012,938 (GRCm39) I668T probably benign Het
Frmpd4 A T X: 166,260,243 (GRCm39) D1166E probably benign Het
Ftdc1 A T 16: 58,434,342 (GRCm39) I125K probably benign Het
Gria2 G A 3: 80,609,799 (GRCm39) T670I probably damaging Het
Grid2ip C A 5: 143,343,684 (GRCm39) Q127K probably benign Het
Hdhd2 T C 18: 77,042,702 (GRCm39) F44L probably damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hmcn1 A T 1: 150,614,467 (GRCm39) V1313D possibly damaging Het
Ift172 C T 5: 31,415,205 (GRCm39) V1335I probably benign Het
Ighv2-2 G A 12: 113,552,118 (GRCm39) T40I possibly damaging Het
Kcnk10 T A 12: 98,401,072 (GRCm39) R520S probably benign Het
Klf8 A T X: 152,165,678 (GRCm39) E82D probably damaging Het
Kpna7 T C 5: 144,930,745 (GRCm39) T367A probably benign Het
Lpo A G 11: 87,707,350 (GRCm39) I221T possibly damaging Het
Lrrn3 T C 12: 41,502,722 (GRCm39) I532V probably benign Het
Matr3 T A 18: 35,705,349 (GRCm39) S91R probably benign Het
Mki67 G A 7: 135,309,878 (GRCm39) P191L probably benign Het
Mlxip A G 5: 123,590,730 (GRCm39) M878V probably benign Het
Mpp7 G A 18: 7,461,678 (GRCm39) P65L possibly damaging Het
Mroh2a C A 1: 88,183,287 (GRCm39) L1292I probably damaging Het
Msh2 C A 17: 87,993,012 (GRCm39) Q314K possibly damaging Het
Mtor T A 4: 148,624,487 (GRCm39) M2089K probably benign Het
Myo9b G A 8: 71,786,981 (GRCm39) R721Q probably benign Het
Nlrp4b C T 7: 10,444,170 (GRCm39) Q40* probably null Het
Nomo1 C A 7: 45,696,361 (GRCm39) T293N probably damaging Het
Notum A G 11: 120,551,022 (GRCm39) V48A probably benign Het
Npas3 C T 12: 54,114,796 (GRCm39) R542* probably null Het
Or10z1 T C 1: 174,078,092 (GRCm39) S134G probably benign Het
Or13a17 A G 7: 140,271,198 (GRCm39) I127V possibly damaging Het
Or13j1 C A 4: 43,706,458 (GRCm39) V37L probably benign Het
Or5t16 A T 2: 86,819,192 (GRCm39) C109* probably null Het
Ostc T C 3: 130,497,157 (GRCm39) N80S probably damaging Het
Palmd T C 3: 116,717,400 (GRCm39) R366G possibly damaging Het
Parp1 A G 1: 180,401,230 (GRCm39) D45G probably damaging Het
Pcdhga9 T A 18: 37,870,524 (GRCm39) Y118N possibly damaging Het
Pes1 C A 11: 3,926,834 (GRCm39) T372K probably benign Het
Pkp4 C A 2: 59,138,500 (GRCm39) T250K probably benign Het
Plekhg5 T A 4: 152,191,960 (GRCm39) C433S probably benign Het
Plin2 A G 4: 86,586,915 (GRCm39) M1T probably null Het
Prdx4 A G X: 154,123,460 (GRCm39) V15A probably benign Het
Psmb8 T C 17: 34,419,144 (GRCm39) I146T probably damaging Het
Psmd13 A T 7: 140,466,968 (GRCm39) T116S probably damaging Het
Rel T C 11: 23,711,129 (GRCm39) I13V probably benign Het
Reln C T 5: 22,254,789 (GRCm39) V527I possibly damaging Het
Rnf6 T C 5: 146,147,215 (GRCm39) Y601C probably benign Het
Rps6kc1 T C 1: 190,631,766 (GRCm39) I48M probably damaging Het
Sfi1 CCTCTC CCTCTCTC 11: 3,127,419 (GRCm39) probably benign Het
Shoc1 A C 4: 59,093,850 (GRCm39) L226R probably damaging Het
Slc39a8 T A 3: 135,592,554 (GRCm39) probably null Het
Sppl2c C T 11: 104,078,141 (GRCm39) P314S probably benign Het
Tnni3k C T 3: 154,644,387 (GRCm39) probably null Het
Ugt1a1 AT A 1: 88,140,093 (GRCm39) probably null Het
Vmn2r68 A C 7: 84,882,834 (GRCm39) M306R probably benign Het
Vmn2r70 T A 7: 85,208,227 (GRCm39) Y750F probably damaging Het
Vwa7 G A 17: 35,240,218 (GRCm39) M395I probably damaging Het
Zfp53 A T 17: 21,728,340 (GRCm39) E124D probably benign Het
Other mutations in Kif1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00775:Kif1c APN 11 70,614,960 (GRCm39) splice site probably null
IGL00817:Kif1c APN 11 70,596,079 (GRCm39) missense probably benign 0.25
IGL00849:Kif1c APN 11 70,596,953 (GRCm39) missense probably damaging 1.00
IGL01988:Kif1c APN 11 70,595,762 (GRCm39) missense probably damaging 1.00
IGL02683:Kif1c APN 11 70,617,278 (GRCm39) missense possibly damaging 0.85
IGL03024:Kif1c APN 11 70,596,015 (GRCm39) missense probably damaging 1.00
R0570:Kif1c UTSW 11 70,595,291 (GRCm39) missense probably damaging 0.96
R0647:Kif1c UTSW 11 70,616,967 (GRCm39) missense probably damaging 1.00
R0710:Kif1c UTSW 11 70,617,323 (GRCm39) missense probably benign
R1112:Kif1c UTSW 11 70,615,641 (GRCm39) splice site probably null
R1199:Kif1c UTSW 11 70,599,427 (GRCm39) missense possibly damaging 0.69
R1514:Kif1c UTSW 11 70,596,555 (GRCm39) missense probably damaging 1.00
R1660:Kif1c UTSW 11 70,619,223 (GRCm39) missense probably damaging 0.99
R1661:Kif1c UTSW 11 70,619,223 (GRCm39) missense probably damaging 0.99
R1666:Kif1c UTSW 11 70,619,223 (GRCm39) missense probably damaging 0.99
R1669:Kif1c UTSW 11 70,619,223 (GRCm39) missense probably damaging 0.99
R1707:Kif1c UTSW 11 70,619,223 (GRCm39) missense probably damaging 0.99
R1708:Kif1c UTSW 11 70,619,223 (GRCm39) missense probably damaging 0.99
R1835:Kif1c UTSW 11 70,599,797 (GRCm39) missense probably damaging 0.99
R1861:Kif1c UTSW 11 70,594,168 (GRCm39) missense probably damaging 1.00
R2870:Kif1c UTSW 11 70,614,907 (GRCm39) missense probably damaging 0.99
R2870:Kif1c UTSW 11 70,614,907 (GRCm39) missense probably damaging 0.99
R2871:Kif1c UTSW 11 70,614,907 (GRCm39) missense probably damaging 0.99
R2872:Kif1c UTSW 11 70,614,907 (GRCm39) missense probably damaging 0.99
R2872:Kif1c UTSW 11 70,614,907 (GRCm39) missense probably damaging 0.99
R2927:Kif1c UTSW 11 70,617,140 (GRCm39) missense probably benign
R3720:Kif1c UTSW 11 70,594,597 (GRCm39) missense possibly damaging 0.94
R4809:Kif1c UTSW 11 70,617,183 (GRCm39) missense probably benign 0.10
R4914:Kif1c UTSW 11 70,599,681 (GRCm39) missense probably damaging 0.99
R5642:Kif1c UTSW 11 70,599,273 (GRCm39) missense probably benign 0.14
R5788:Kif1c UTSW 11 70,599,654 (GRCm39) missense probably damaging 1.00
R5861:Kif1c UTSW 11 70,594,621 (GRCm39) missense probably damaging 1.00
R6918:Kif1c UTSW 11 70,597,813 (GRCm39) missense probably damaging 1.00
R7456:Kif1c UTSW 11 70,619,424 (GRCm39) missense probably benign 0.00
R7857:Kif1c UTSW 11 70,619,103 (GRCm39) missense probably benign
R8841:Kif1c UTSW 11 70,615,659 (GRCm39) missense probably benign 0.02
R9004:Kif1c UTSW 11 70,615,958 (GRCm39) missense probably benign 0.30
R9117:Kif1c UTSW 11 70,595,798 (GRCm39) missense probably damaging 1.00
R9714:Kif1c UTSW 11 70,615,660 (GRCm39) missense probably benign 0.29
Z1177:Kif1c UTSW 11 70,593,719 (GRCm39) missense probably damaging 1.00
Z1186:Kif1c UTSW 11 70,614,940 (GRCm39) missense probably benign 0.25
Z1187:Kif1c UTSW 11 70,614,940 (GRCm39) missense probably benign 0.25
Z1188:Kif1c UTSW 11 70,614,940 (GRCm39) missense probably benign 0.25
Z1189:Kif1c UTSW 11 70,614,940 (GRCm39) missense probably benign 0.25
Z1190:Kif1c UTSW 11 70,614,940 (GRCm39) missense probably benign 0.25
Z1191:Kif1c UTSW 11 70,614,940 (GRCm39) missense probably benign 0.25
Z1192:Kif1c UTSW 11 70,614,940 (GRCm39) missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TTCTGGGAGTCACAGTAGGG -3'
(R):5'- ACCTGTACTCTGTAACACAGC -3'

Sequencing Primer
(F):5'- GAGTCACAGTAGGGTCTCTAAC -3'
(R):5'- TGTACTCTGTAACACAGCTTTTG -3'
Posted On 2014-12-04