Mutagenetix > Incidental Mutation

Incidental Mutation 'R2871:Npas3'

253766

Institutional Source

Beutler Lab

Gene Symbol

Npas3

Ensembl Gene

ENSMUSG00000021010

Gene Name

neuronal PAS domain protein 3

Synonyms

4930423H22Rik, bHLHe12

MMRRC Submission

040459-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.922) question?

Stock #

R2871 (G1)

Quality Score

207

Status

Not validated

Chromosome

Chromosomal Location

53248677-54072175 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 54068013 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 542 (R542*)

Ref Sequence

ENSEMBL: ENSMUSP00000152411 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000101432] [ENSMUST00000223057] [ENSMUST00000223358]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000101432
AA Change: R573*

SMART Domains

Protein: ENSMUSP00000098975
Gene: ENSMUSG00000021010
AA Change: R573*

Domain	Start	End	E-Value	Type
HLH	64	119	1.34e-6	SMART
PAS	154	220	8.69e-11	SMART
low complexity region	234	256	N/A	INTRINSIC
PAS	326	392	7.4e-5	SMART
PAC	398	441	2.46e-1	SMART
low complexity region	461	477	N/A	INTRINSIC
low complexity region	524	544	N/A	INTRINSIC
low complexity region	598	627	N/A	INTRINSIC
low complexity region	696	709	N/A	INTRINSIC
low complexity region	739	754	N/A	INTRINSIC
low complexity region	759	773	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185390

Predicted Effect

probably null
Transcript: ENSMUST00000223057
AA Change: R555*

Predicted Effect

probably null
Transcript: ENSMUST00000223358
AA Change: R542*

Coding Region Coverage

1x: 99.5%
3x: 98.2%
10x: 92.4%
20x: 72.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the basic helix-loop-helix and PAS domain-containing family of transcription factors. The encoded protein is localized to the nucleus and may regulate genes involved in neurogenesis. Chromosomal abnormalities that affect the coding potential of this gene are associated with schizophrenia and mental retardation. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for some knock-out alleles exhibit abnormal behavior and nervous system morphology. Mice homozygous for another knock-out allele exhibit defective lung branching morphogenesis and die shortly after birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	A	G	11: 109,955,176	C811R	possibly damaging	Het
AI481877	A	C	4: 59,093,850	L226R	probably damaging	Het
Akap8l	G	A	17: 32,338,442	T65I	possibly damaging	Het
Arid4a	T	A	12: 71,022,260		probably null	Het
Armc2	C	T	10: 41,966,700		probably null	Het
Atp6v1g1	A	G	4: 63,550,021	Y87C	probably benign	Het
Cfap54	A	T	10: 92,921,419	F273I	possibly damaging	Het
Clasrp	C	A	7: 19,585,240		probably benign	Het
Csmd2	T	C	4: 128,557,718	F113S	unknown	Het
Cyp4a14	C	A	4: 115,487,301	G456W	probably damaging	Het
Cyp4a30b	A	G	4: 115,458,362	H260R	possibly damaging	Het
Ddrgk1	T	A	2: 130,664,644		probably benign	Het
Dhx57	A	T	17: 80,251,376	D1051E	probably benign	Het
Eef2	GCCC	GCCCC	10: 81,178,767		probably null	Het
Eif4enif1	C	T	11: 3,242,586	P805S	probably damaging	Het
Eml5	C	T	12: 98,865,401	D433N	probably damaging	Het
Fan1	A	G	7: 64,363,190	I668T	probably benign	Het
Frmpd4	A	T	X: 167,477,247	D1166E	probably benign	Het
Gm813	A	T	16: 58,613,979	I125K	probably benign	Het
Gria2	G	A	3: 80,702,492	T670I	probably damaging	Het
Grid2ip	C	A	5: 143,357,929	Q127K	probably benign	Het
Hdhd2	T	C	18: 76,955,006	F44L	probably damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hmcn1	A	T	1: 150,738,716	V1313D	possibly damaging	Het
Ift172	C	T	5: 31,257,861	V1335I	probably benign	Het
Ighv2-2	G	A	12: 113,588,498	T40I	possibly damaging	Het
Kcnk10	T	A	12: 98,434,813	R520S	probably benign	Het
Kif1c	A	G	11: 70,724,081	E567G	probably damaging	Het
Klf8	A	T	X: 153,382,682	E82D	probably damaging	Het
Kpna7	T	C	5: 144,993,935	T367A	probably benign	Het
Lpo	A	G	11: 87,816,524	I221T	possibly damaging	Het
Lrrn3	T	C	12: 41,452,723	I532V	probably benign	Het
Matr3	T	A	18: 35,572,296	S91R	probably benign	Het
Mki67	G	A	7: 135,708,149	P191L	probably benign	Het
Mlxip	A	G	5: 123,452,667	M878V	probably benign	Het
Mpp7	G	A	18: 7,461,678	P65L	possibly damaging	Het
Mroh2a	C	A	1: 88,255,565	L1292I	probably damaging	Het
Msh2	C	A	17: 87,685,584	Q314K	possibly damaging	Het
Mtor	T	A	4: 148,540,030	M2089K	probably benign	Het
Myo9b	G	A	8: 71,334,337	R721Q	probably benign	Het
Nlrp4b	C	T	7: 10,710,243	Q40*	probably null	Het
Nomo1	C	A	7: 46,046,937	T293N	probably damaging	Het
Notum	A	G	11: 120,660,196	V48A	probably benign	Het
Olfr1101	A	T	2: 86,988,848	C109*	probably null	Het
Olfr419	T	C	1: 174,250,526	S134G	probably benign	Het
Olfr45	A	G	7: 140,691,285	I127V	possibly damaging	Het
Olfr71	C	A	4: 43,706,458	V37L	probably benign	Het
Ostc	T	C	3: 130,703,508	N80S	probably damaging	Het
Palmd	T	C	3: 116,923,751	R366G	possibly damaging	Het
Parp1	A	G	1: 180,573,665	D45G	probably damaging	Het
Pcdhga9	T	A	18: 37,737,471	Y118N	possibly damaging	Het
Pes1	C	A	11: 3,976,834	T372K	probably benign	Het
Pkp4	C	A	2: 59,308,156	T250K	probably benign	Het
Plekhg5	T	A	4: 152,107,503	C433S	probably benign	Het
Plin2	A	G	4: 86,668,678	M1T	probably null	Het
Prdx4	A	G	X: 155,340,464	V15A	probably benign	Het
Psmb8	T	C	17: 34,200,170	I146T	probably damaging	Het
Psmd13	A	T	7: 140,887,055	T116S	probably damaging	Het
Rel	T	C	11: 23,761,129	I13V	probably benign	Het
Reln	C	T	5: 22,049,791	V527I	possibly damaging	Het
Rnf6	T	C	5: 146,210,405	Y601C	probably benign	Het
Rps6kc1	T	C	1: 190,899,569	I48M	probably damaging	Het
Sfi1	CCTCTC	CCTCTCTC	11: 3,177,419		probably benign	Het
Slc39a8	T	A	3: 135,886,793		probably null	Het
Sppl2c	C	T	11: 104,187,315	P314S	probably benign	Het
St5	A	T	7: 109,557,430	Y38N	probably benign	Het
Tnni3k	C	T	3: 154,938,750		probably null	Het
Ugt1a1	AT	A	1: 88,212,371		probably null	Het
Vmn2r68	A	C	7: 85,233,626	M306R	probably benign	Het
Vmn2r70	T	A	7: 85,559,019	Y750F	probably damaging	Het
Vwa7	G	A	17: 35,021,242	M395I	probably damaging	Het
Zfp53	A	T	17: 21,508,078	E124D	probably benign	Het

Other mutations in Npas3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01021:Npas3	APN	12	54003560	missense	probably damaging	1.00
IGL01330:Npas3	APN	12	54048819	missense	probably damaging	1.00
IGL01376:Npas3	APN	12	54044586	missense	probably benign	0.01
IGL01634:Npas3	APN	12	53947163	missense	probably damaging	1.00
IGL02456:Npas3	APN	12	54048767	missense	probably damaging	0.99
IGL02663:Npas3	APN	12	54068908	missense	probably damaging	1.00
IGL02731:Npas3	APN	12	54067795	missense	probably benign	0.01
IGL02955:Npas3	APN	12	53501265	missense	probably damaging	0.96
IGL03001:Npas3	APN	12	53501192	missense	probably damaging	1.00
IGL03047:Npas3	APN	12	53831687	splice site	probably benign
ANU05:Npas3	UTSW	12	54068074	missense	possibly damaging	0.49
IGL02837:Npas3	UTSW	12	53947197	missense	possibly damaging	0.79
R0042:Npas3	UTSW	12	54048841	missense	probably damaging	1.00
R0042:Npas3	UTSW	12	54048841	missense	probably damaging	1.00
R0396:Npas3	UTSW	12	53831745	missense	probably damaging	1.00
R1687:Npas3	UTSW	12	54048875	splice site	probably null
R1863:Npas3	UTSW	12	54068826	missense	probably damaging	1.00
R2004:Npas3	UTSW	12	54067897	missense	possibly damaging	0.63
R2047:Npas3	UTSW	12	54068829	missense	probably damaging	0.99
R2049:Npas3	UTSW	12	54062088	missense	probably damaging	1.00
R2278:Npas3	UTSW	12	53640502	missense	possibly damaging	0.92
R2323:Npas3	UTSW	12	54068346	missense	probably damaging	1.00
R2871:Npas3	UTSW	12	54068013	nonsense	probably null
R3116:Npas3	UTSW	12	54067725	splice site	probably null
R3431:Npas3	UTSW	12	54069049	missense	probably damaging	0.99
R3731:Npas3	UTSW	12	53354392	missense	probably benign	0.11
R3767:Npas3	UTSW	12	54069074	makesense	probably null
R4332:Npas3	UTSW	12	54062069	missense	probably damaging	0.99
R4593:Npas3	UTSW	12	54068497	missense	probably benign	0.08
R4601:Npas3	UTSW	12	54044578	missense	probably damaging	0.99
R4654:Npas3	UTSW	12	54062132	critical splice donor site	probably null
R4946:Npas3	UTSW	12	54065835	missense	probably damaging	1.00
R5140:Npas3	UTSW	12	53501114	nonsense	probably null
R5302:Npas3	UTSW	12	54068836	missense	probably damaging	1.00
R5524:Npas3	UTSW	12	54068938	missense	possibly damaging	0.64
R5735:Npas3	UTSW	12	54003479	missense	probably benign	0.00
R6252:Npas3	UTSW	12	54068890	missense	probably damaging	1.00
R6438:Npas3	UTSW	12	54068698	missense	probably damaging	0.99
R6987:Npas3	UTSW	12	54068253	missense	possibly damaging	0.94
R6994:Npas3	UTSW	12	54068793	missense	probably damaging	0.96
R7304:Npas3	UTSW	12	54069041	missense	probably damaging	1.00
R7684:Npas3	UTSW	12	54068826	missense	probably damaging	1.00
R7724:Npas3	UTSW	12	54068341	missense	possibly damaging	0.90
R7739:Npas3	UTSW	12	54068718	missense	probably damaging	1.00
R7826:Npas3	UTSW	12	53831756	missense	possibly damaging	0.92
R8017:Npas3	UTSW	12	54044679	missense	probably damaging	1.00
R8019:Npas3	UTSW	12	54044679	missense	probably damaging	1.00
R8034:Npas3	UTSW	12	53640529	missense	probably damaging	1.00
R8422:Npas3	UTSW	12	54068509	missense	probably benign
R9172:Npas3	UTSW	12	54065870	missense	probably benign	0.08
R9207:Npas3	UTSW	12	54068035	missense	possibly damaging	0.87
R9774:Npas3	UTSW	12	53947325	missense	probably damaging	1.00
X0003:Npas3	UTSW	12	54044728	splice site	probably null
X0064:Npas3	UTSW	12	53354384	missense	probably damaging	0.96
Z1176:Npas3	UTSW	12	53501180	missense	probably damaging	0.99
Z1177:Npas3	UTSW	12	53947206	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAACTGCAACGACGATGGC -3'
(R):5'- TTGATCTTGAGCACAGAGGC -3'

Sequencing Primer
(F):5'- GCAACGACGATGGCCACAG -3'
(R):5'- TGCGGCGATGACAGCAG -3'

Posted On

2014-12-04