Incidental Mutation 'R2871:Psmb8'
ID 253786
Institutional Source Beutler Lab
Gene Symbol Psmb8
Ensembl Gene ENSMUSG00000024338
Gene Name proteasome (prosome, macropain) subunit, beta type 8 (large multifunctional peptidase 7)
Synonyms Lmp-7, Lmp7
MMRRC Submission 040459-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2871 (G1)
Quality Score 212
Status Not validated
Chromosome 17
Chromosomal Location 34417169-34420428 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34419144 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 146 (I146T)
Ref Sequence ENSEMBL: ENSMUSP00000134664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025196] [ENSMUST00000025197] [ENSMUST00000041633] [ENSMUST00000131105] [ENSMUST00000138491] [ENSMUST00000173441] [ENSMUST00000170086]
AlphaFold P28063
Predicted Effect probably damaging
Transcript: ENSMUST00000025196
AA Change: I146T

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025196
Gene: ENSMUSG00000024338
AA Change: I146T

DomainStartEndE-ValueType
Pfam:Proteasome 69 251 1.9e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025197
SMART Domains Protein: ENSMUSP00000025197
Gene: ENSMUSG00000024339

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 97 119 N/A INTRINSIC
Pfam:ABC_membrane 151 419 1.8e-62 PFAM
AAA 494 678 2.58e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000041633
SMART Domains Protein: ENSMUSP00000039264
Gene: ENSMUSG00000037321

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
transmembrane domain 116 138 N/A INTRINSIC
Pfam:ABC_membrane 163 420 9.1e-55 PFAM
AAA 478 666 2.21e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127543
Predicted Effect probably benign
Transcript: ENSMUST00000131105
SMART Domains Protein: ENSMUSP00000118700
Gene: ENSMUSG00000024339

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138491
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172960
Predicted Effect probably damaging
Transcript: ENSMUST00000173441
AA Change: I146T

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134664
Gene: ENSMUSG00000024338
AA Change: I146T

DomainStartEndE-ValueType
Pfam:Proteasome 69 248 6.3e-53 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173770
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166853
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168351
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172796
Predicted Effect probably benign
Transcript: ENSMUST00000170086
SMART Domains Protein: ENSMUSP00000128401
Gene: ENSMUSG00000037321

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
transmembrane domain 116 138 N/A INTRINSIC
Pfam:ABC_membrane 163 434 5.8e-70 PFAM
AAA 506 694 2.21e-18 SMART
Meta Mutation Damage Score 0.7752 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.2%
  • 10x: 92.4%
  • 20x: 72.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit. This gene is located in the class II region of the MHC (major histocompatibility complex). Expression of this gene is induced by gamma interferon and this gene product replaces catalytic subunit 3 (proteasome beta 5 subunit) in the immunoproteasome. Proteolytic processing is required to generate a mature subunit. Two alternative transcripts encoding two isoforms have been identified; both isoforms are processed to yield the same mature subunit. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display an essentially normal phenotype. However they have a reduced ability to process MHC class I restricted antigens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,846,002 (GRCm39) C811R possibly damaging Het
Akap8l G A 17: 32,557,416 (GRCm39) T65I possibly damaging Het
Arid4a T A 12: 71,069,034 (GRCm39) probably null Het
Armc2 C T 10: 41,842,696 (GRCm39) probably null Het
Atp6v1g1 A G 4: 63,468,258 (GRCm39) Y87C probably benign Het
Cfap54 A T 10: 92,757,281 (GRCm39) F273I possibly damaging Het
Clasrp C A 7: 19,319,165 (GRCm39) probably benign Het
Csmd2 T C 4: 128,451,511 (GRCm39) F113S unknown Het
Cyp4a14 C A 4: 115,344,498 (GRCm39) G456W probably damaging Het
Cyp4a30b A G 4: 115,315,559 (GRCm39) H260R possibly damaging Het
Ddrgk1 T A 2: 130,506,564 (GRCm39) probably benign Het
Dennd2b A T 7: 109,156,637 (GRCm39) Y38N probably benign Het
Dhx57 A T 17: 80,558,805 (GRCm39) D1051E probably benign Het
Eef2 GCCC GCCCC 10: 81,014,601 (GRCm39) probably null Het
Eif4enif1 C T 11: 3,192,586 (GRCm39) P805S probably damaging Het
Eml5 C T 12: 98,831,660 (GRCm39) D433N probably damaging Het
Fan1 A G 7: 64,012,938 (GRCm39) I668T probably benign Het
Frmpd4 A T X: 166,260,243 (GRCm39) D1166E probably benign Het
Ftdc1 A T 16: 58,434,342 (GRCm39) I125K probably benign Het
Gria2 G A 3: 80,609,799 (GRCm39) T670I probably damaging Het
Grid2ip C A 5: 143,343,684 (GRCm39) Q127K probably benign Het
Hdhd2 T C 18: 77,042,702 (GRCm39) F44L probably damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hmcn1 A T 1: 150,614,467 (GRCm39) V1313D possibly damaging Het
Ift172 C T 5: 31,415,205 (GRCm39) V1335I probably benign Het
Ighv2-2 G A 12: 113,552,118 (GRCm39) T40I possibly damaging Het
Kcnk10 T A 12: 98,401,072 (GRCm39) R520S probably benign Het
Kif1c A G 11: 70,614,907 (GRCm39) E567G probably damaging Het
Klf8 A T X: 152,165,678 (GRCm39) E82D probably damaging Het
Kpna7 T C 5: 144,930,745 (GRCm39) T367A probably benign Het
Lpo A G 11: 87,707,350 (GRCm39) I221T possibly damaging Het
Lrrn3 T C 12: 41,502,722 (GRCm39) I532V probably benign Het
Matr3 T A 18: 35,705,349 (GRCm39) S91R probably benign Het
Mki67 G A 7: 135,309,878 (GRCm39) P191L probably benign Het
Mlxip A G 5: 123,590,730 (GRCm39) M878V probably benign Het
Mpp7 G A 18: 7,461,678 (GRCm39) P65L possibly damaging Het
Mroh2a C A 1: 88,183,287 (GRCm39) L1292I probably damaging Het
Msh2 C A 17: 87,993,012 (GRCm39) Q314K possibly damaging Het
Mtor T A 4: 148,624,487 (GRCm39) M2089K probably benign Het
Myo9b G A 8: 71,786,981 (GRCm39) R721Q probably benign Het
Nlrp4b C T 7: 10,444,170 (GRCm39) Q40* probably null Het
Nomo1 C A 7: 45,696,361 (GRCm39) T293N probably damaging Het
Notum A G 11: 120,551,022 (GRCm39) V48A probably benign Het
Npas3 C T 12: 54,114,796 (GRCm39) R542* probably null Het
Or10z1 T C 1: 174,078,092 (GRCm39) S134G probably benign Het
Or13a17 A G 7: 140,271,198 (GRCm39) I127V possibly damaging Het
Or13j1 C A 4: 43,706,458 (GRCm39) V37L probably benign Het
Or5t16 A T 2: 86,819,192 (GRCm39) C109* probably null Het
Ostc T C 3: 130,497,157 (GRCm39) N80S probably damaging Het
Palmd T C 3: 116,717,400 (GRCm39) R366G possibly damaging Het
Parp1 A G 1: 180,401,230 (GRCm39) D45G probably damaging Het
Pcdhga9 T A 18: 37,870,524 (GRCm39) Y118N possibly damaging Het
Pes1 C A 11: 3,926,834 (GRCm39) T372K probably benign Het
Pkp4 C A 2: 59,138,500 (GRCm39) T250K probably benign Het
Plekhg5 T A 4: 152,191,960 (GRCm39) C433S probably benign Het
Plin2 A G 4: 86,586,915 (GRCm39) M1T probably null Het
Prdx4 A G X: 154,123,460 (GRCm39) V15A probably benign Het
Psmd13 A T 7: 140,466,968 (GRCm39) T116S probably damaging Het
Rel T C 11: 23,711,129 (GRCm39) I13V probably benign Het
Reln C T 5: 22,254,789 (GRCm39) V527I possibly damaging Het
Rnf6 T C 5: 146,147,215 (GRCm39) Y601C probably benign Het
Rps6kc1 T C 1: 190,631,766 (GRCm39) I48M probably damaging Het
Sfi1 CCTCTC CCTCTCTC 11: 3,127,419 (GRCm39) probably benign Het
Shoc1 A C 4: 59,093,850 (GRCm39) L226R probably damaging Het
Slc39a8 T A 3: 135,592,554 (GRCm39) probably null Het
Sppl2c C T 11: 104,078,141 (GRCm39) P314S probably benign Het
Tnni3k C T 3: 154,644,387 (GRCm39) probably null Het
Ugt1a1 AT A 1: 88,140,093 (GRCm39) probably null Het
Vmn2r68 A C 7: 84,882,834 (GRCm39) M306R probably benign Het
Vmn2r70 T A 7: 85,208,227 (GRCm39) Y750F probably damaging Het
Vwa7 G A 17: 35,240,218 (GRCm39) M395I probably damaging Het
Zfp53 A T 17: 21,728,340 (GRCm39) E124D probably benign Het
Other mutations in Psmb8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00817:Psmb8 APN 17 34,419,703 (GRCm39) missense probably damaging 0.97
IGL01153:Psmb8 APN 17 34,420,215 (GRCm39) missense possibly damaging 0.82
IGL01307:Psmb8 APN 17 34,418,210 (GRCm39) missense probably benign
IGL01394:Psmb8 APN 17 34,419,703 (GRCm39) missense probably damaging 1.00
IGL01821:Psmb8 APN 17 34,417,517 (GRCm39) missense probably benign
IGL01936:Psmb8 APN 17 34,419,168 (GRCm39) missense probably damaging 1.00
IGL02118:Psmb8 APN 17 34,420,198 (GRCm39) missense probably damaging 0.98
IGL02708:Psmb8 APN 17 34,420,217 (GRCm39) missense probably benign 0.00
IGL02739:Psmb8 APN 17 34,419,728 (GRCm39) nonsense probably null
R1952:Psmb8 UTSW 17 34,419,884 (GRCm39) missense probably damaging 1.00
R2869:Psmb8 UTSW 17 34,419,144 (GRCm39) missense probably damaging 0.98
R2869:Psmb8 UTSW 17 34,419,144 (GRCm39) missense probably damaging 0.98
R2870:Psmb8 UTSW 17 34,419,144 (GRCm39) missense probably damaging 0.98
R2870:Psmb8 UTSW 17 34,419,144 (GRCm39) missense probably damaging 0.98
R2871:Psmb8 UTSW 17 34,419,144 (GRCm39) missense probably damaging 0.98
R2873:Psmb8 UTSW 17 34,419,144 (GRCm39) missense probably damaging 0.98
R2874:Psmb8 UTSW 17 34,419,144 (GRCm39) missense probably damaging 0.98
R5632:Psmb8 UTSW 17 34,420,214 (GRCm39) missense probably benign
R6395:Psmb8 UTSW 17 34,418,265 (GRCm39) missense possibly damaging 0.86
R6993:Psmb8 UTSW 17 34,418,617 (GRCm39) missense probably damaging 1.00
R7645:Psmb8 UTSW 17 34,419,186 (GRCm39) missense possibly damaging 0.76
R7672:Psmb8 UTSW 17 34,417,404 (GRCm39) missense probably benign 0.06
R8804:Psmb8 UTSW 17 34,419,225 (GRCm39) missense probably damaging 1.00
R9492:Psmb8 UTSW 17 34,417,435 (GRCm39) missense probably benign 0.00
Z1176:Psmb8 UTSW 17 34,419,830 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCGGATCAGAGATTTTAAATTCCC -3'
(R):5'- CAAAACCTGGATCAAGCATGGG -3'

Sequencing Primer
(F):5'- ACTCTTATGTCCCGTCCCACAAG -3'
(R):5'- AGATCATGCTGCCCATG -3'
Posted On 2014-12-04