Incidental Mutation 'R2871:Psmb8'
ID253786
Institutional Source Beutler Lab
Gene Symbol Psmb8
Ensembl Gene ENSMUSG00000024338
Gene Nameproteasome (prosome, macropain) subunit, beta type 8 (large multifunctional peptidase 7)
SynonymsLmp7, Lmp-7
MMRRC Submission 040459-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2871 (G1)
Quality Score212
Status Not validated
Chromosome17
Chromosomal Location34197721-34201454 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34200170 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 146 (I146T)
Ref Sequence ENSEMBL: ENSMUSP00000134664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025196] [ENSMUST00000025197] [ENSMUST00000041633] [ENSMUST00000131105] [ENSMUST00000138491] [ENSMUST00000170086] [ENSMUST00000173441]
Predicted Effect probably damaging
Transcript: ENSMUST00000025196
AA Change: I146T

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025196
Gene: ENSMUSG00000024338
AA Change: I146T

DomainStartEndE-ValueType
Pfam:Proteasome 69 251 1.9e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025197
SMART Domains Protein: ENSMUSP00000025197
Gene: ENSMUSG00000024339

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 97 119 N/A INTRINSIC
Pfam:ABC_membrane 151 419 1.8e-62 PFAM
AAA 494 678 2.58e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000041633
SMART Domains Protein: ENSMUSP00000039264
Gene: ENSMUSG00000037321

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
transmembrane domain 116 138 N/A INTRINSIC
Pfam:ABC_membrane 163 420 9.1e-55 PFAM
AAA 478 666 2.21e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127543
Predicted Effect probably benign
Transcript: ENSMUST00000131105
SMART Domains Protein: ENSMUSP00000118700
Gene: ENSMUSG00000024339

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138491
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166853
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168351
Predicted Effect probably benign
Transcript: ENSMUST00000170086
SMART Domains Protein: ENSMUSP00000128401
Gene: ENSMUSG00000037321

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
transmembrane domain 116 138 N/A INTRINSIC
Pfam:ABC_membrane 163 434 5.8e-70 PFAM
AAA 506 694 2.21e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172796
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172960
Predicted Effect probably damaging
Transcript: ENSMUST00000173441
AA Change: I146T

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134664
Gene: ENSMUSG00000024338
AA Change: I146T

DomainStartEndE-ValueType
Pfam:Proteasome 69 248 6.3e-53 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173770
Meta Mutation Damage Score 0.7752 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.2%
  • 10x: 92.4%
  • 20x: 72.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit. This gene is located in the class II region of the MHC (major histocompatibility complex). Expression of this gene is induced by gamma interferon and this gene product replaces catalytic subunit 3 (proteasome beta 5 subunit) in the immunoproteasome. Proteolytic processing is required to generate a mature subunit. Two alternative transcripts encoding two isoforms have been identified; both isoforms are processed to yield the same mature subunit. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display an essentially normal phenotype. However they have a reduced ability to process MHC class I restricted antigens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,955,176 C811R possibly damaging Het
AI481877 A C 4: 59,093,850 L226R probably damaging Het
Akap8l G A 17: 32,338,442 T65I possibly damaging Het
Arid4a T A 12: 71,022,260 probably null Het
Armc2 C T 10: 41,966,700 probably null Het
Atp6v1g1 A G 4: 63,550,021 Y87C probably benign Het
Cfap54 A T 10: 92,921,419 F273I possibly damaging Het
Clasrp C A 7: 19,585,240 probably benign Het
Csmd2 T C 4: 128,557,718 F113S unknown Het
Cyp4a14 C A 4: 115,487,301 G456W probably damaging Het
Cyp4a30b A G 4: 115,458,362 H260R possibly damaging Het
Ddrgk1 T A 2: 130,664,644 probably benign Het
Dhx57 A T 17: 80,251,376 D1051E probably benign Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Eif4enif1 C T 11: 3,242,586 P805S probably damaging Het
Eml5 C T 12: 98,865,401 D433N probably damaging Het
Fan1 A G 7: 64,363,190 I668T probably benign Het
Frmpd4 A T X: 167,477,247 D1166E probably benign Het
Gm813 A T 16: 58,613,979 I125K probably benign Het
Gria2 G A 3: 80,702,492 T670I probably damaging Het
Grid2ip C A 5: 143,357,929 Q127K probably benign Het
Hdhd2 T C 18: 76,955,006 F44L probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hmcn1 A T 1: 150,738,716 V1313D possibly damaging Het
Ift172 C T 5: 31,257,861 V1335I probably benign Het
Ighv2-2 G A 12: 113,588,498 T40I possibly damaging Het
Kcnk10 T A 12: 98,434,813 R520S probably benign Het
Kif1c A G 11: 70,724,081 E567G probably damaging Het
Klf8 A T X: 153,382,682 E82D probably damaging Het
Kpna7 T C 5: 144,993,935 T367A probably benign Het
Lpo A G 11: 87,816,524 I221T possibly damaging Het
Lrrn3 T C 12: 41,452,723 I532V probably benign Het
Matr3 T A 18: 35,572,296 S91R probably benign Het
Mki67 G A 7: 135,708,149 P191L probably benign Het
Mlxip A G 5: 123,452,667 M878V probably benign Het
Mpp7 G A 18: 7,461,678 P65L possibly damaging Het
Mroh2a C A 1: 88,255,565 L1292I probably damaging Het
Msh2 C A 17: 87,685,584 Q314K possibly damaging Het
Mtor T A 4: 148,540,030 M2089K probably benign Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nlrp4b C T 7: 10,710,243 Q40* probably null Het
Nomo1 C A 7: 46,046,937 T293N probably damaging Het
Notum A G 11: 120,660,196 V48A probably benign Het
Npas3 C T 12: 54,068,013 R542* probably null Het
Olfr1101 A T 2: 86,988,848 C109* probably null Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Olfr45 A G 7: 140,691,285 I127V possibly damaging Het
Olfr71 C A 4: 43,706,458 V37L probably benign Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Pcdhga9 T A 18: 37,737,471 Y118N possibly damaging Het
Pes1 C A 11: 3,976,834 T372K probably benign Het
Pkp4 C A 2: 59,308,156 T250K probably benign Het
Plekhg5 T A 4: 152,107,503 C433S probably benign Het
Plin2 A G 4: 86,668,678 M1T probably null Het
Prdx4 A G X: 155,340,464 V15A probably benign Het
Psmd13 A T 7: 140,887,055 T116S probably damaging Het
Rel T C 11: 23,761,129 I13V probably benign Het
Reln C T 5: 22,049,791 V527I possibly damaging Het
Rnf6 T C 5: 146,210,405 Y601C probably benign Het
Rps6kc1 T C 1: 190,899,569 I48M probably damaging Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Slc39a8 T A 3: 135,886,793 probably null Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
St5 A T 7: 109,557,430 Y38N probably benign Het
Tnni3k C T 3: 154,938,750 probably null Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vmn2r70 T A 7: 85,559,019 Y750F probably damaging Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Other mutations in Psmb8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00817:Psmb8 APN 17 34200729 missense probably damaging 0.97
IGL01153:Psmb8 APN 17 34201241 missense possibly damaging 0.82
IGL01307:Psmb8 APN 17 34199236 missense probably benign
IGL01394:Psmb8 APN 17 34200729 missense probably damaging 1.00
IGL01821:Psmb8 APN 17 34198543 missense probably benign
IGL01936:Psmb8 APN 17 34200194 missense probably damaging 1.00
IGL02118:Psmb8 APN 17 34201224 missense probably damaging 0.98
IGL02708:Psmb8 APN 17 34201243 missense probably benign 0.00
IGL02739:Psmb8 APN 17 34200754 nonsense probably null
R1952:Psmb8 UTSW 17 34200910 missense probably damaging 1.00
R2869:Psmb8 UTSW 17 34200170 missense probably damaging 0.98
R2869:Psmb8 UTSW 17 34200170 missense probably damaging 0.98
R2870:Psmb8 UTSW 17 34200170 missense probably damaging 0.98
R2870:Psmb8 UTSW 17 34200170 missense probably damaging 0.98
R2871:Psmb8 UTSW 17 34200170 missense probably damaging 0.98
R2873:Psmb8 UTSW 17 34200170 missense probably damaging 0.98
R2874:Psmb8 UTSW 17 34200170 missense probably damaging 0.98
R5632:Psmb8 UTSW 17 34201240 missense probably benign
R6395:Psmb8 UTSW 17 34199291 missense possibly damaging 0.86
R6993:Psmb8 UTSW 17 34199643 missense probably damaging 1.00
R7645:Psmb8 UTSW 17 34200212 missense possibly damaging 0.76
R7672:Psmb8 UTSW 17 34198430 missense probably benign 0.06
R8804:Psmb8 UTSW 17 34200251 missense probably damaging 1.00
Z1176:Psmb8 UTSW 17 34200856 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCGGATCAGAGATTTTAAATTCCC -3'
(R):5'- CAAAACCTGGATCAAGCATGGG -3'

Sequencing Primer
(F):5'- ACTCTTATGTCCCGTCCCACAAG -3'
(R):5'- AGATCATGCTGCCCATG -3'
Posted On2014-12-04