Incidental Mutation 'R2516:Trpm5'
ID253797
Institutional Source Beutler Lab
Gene Symbol Trpm5
Ensembl Gene ENSMUSG00000009246
Gene Nametransient receptor potential cation channel, subfamily M, member 5
Synonyms9430099A16Rik, Mtr1, Ltrpc5
MMRRC Submission 040420-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R2516 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location143069153-143094642 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 143074517 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 1007 (P1007Q)
Ref Sequence ENSEMBL: ENSMUSP00000009390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009390] [ENSMUST00000060433] [ENSMUST00000105920] [ENSMUST00000133410] [ENSMUST00000137856] [ENSMUST00000147995] [ENSMUST00000150867] [ENSMUST00000208779] [ENSMUST00000177841]
Predicted Effect probably damaging
Transcript: ENSMUST00000009390
AA Change: P1007Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000009390
Gene: ENSMUSG00000009246
AA Change: P1007Q

DomainStartEndE-ValueType
Blast:ANK 382 411 2e-6 BLAST
transmembrane domain 644 666 N/A INTRINSIC
Pfam:Ion_trans 736 989 1.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060433
SMART Domains Protein: ENSMUSP00000056582
Gene: ENSMUSG00000045752

DomainStartEndE-ValueType
low complexity region 16 37 N/A INTRINSIC
low complexity region 55 69 N/A INTRINSIC
Pfam:TSSC4 91 207 3.9e-43 PFAM
low complexity region 232 250 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105920
SMART Domains Protein: ENSMUSP00000101540
Gene: ENSMUSG00000045752

DomainStartEndE-ValueType
low complexity region 16 37 N/A INTRINSIC
low complexity region 55 69 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126776
Predicted Effect probably benign
Transcript: ENSMUST00000133410
SMART Domains Protein: ENSMUSP00000123499
Gene: ENSMUSG00000045752

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
low complexity region 85 106 N/A INTRINSIC
low complexity region 124 138 N/A INTRINSIC
Pfam:TSSC4 159 266 5.2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136602
Predicted Effect probably benign
Transcript: ENSMUST00000137856
SMART Domains Protein: ENSMUSP00000123353
Gene: ENSMUSG00000045752

DomainStartEndE-ValueType
low complexity region 16 37 N/A INTRINSIC
low complexity region 55 69 N/A INTRINSIC
Pfam:TSSC4 90 209 1.6e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146075
Predicted Effect probably benign
Transcript: ENSMUST00000147995
SMART Domains Protein: ENSMUSP00000122335
Gene: ENSMUSG00000045752

DomainStartEndE-ValueType
low complexity region 16 37 N/A INTRINSIC
low complexity region 55 69 N/A INTRINSIC
Pfam:TSSC4 90 196 4.8e-30 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000148715
AA Change: P15Q
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150589
Predicted Effect probably benign
Transcript: ENSMUST00000150867
SMART Domains Protein: ENSMUSP00000114302
Gene: ENSMUSG00000009246

DomainStartEndE-ValueType
Blast:ANK 382 411 2e-6 BLAST
transmembrane domain 644 666 N/A INTRINSIC
transmembrane domain 731 753 N/A INTRINSIC
transmembrane domain 811 833 N/A INTRINSIC
transmembrane domain 872 894 N/A INTRINSIC
transmembrane domain 952 974 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207776
Predicted Effect probably benign
Transcript: ENSMUST00000208779
Predicted Effect probably benign
Transcript: ENSMUST00000177841
SMART Domains Protein: ENSMUSP00000137399
Gene: ENSMUSG00000045752

DomainStartEndE-ValueType
low complexity region 16 37 N/A INTRINSIC
low complexity region 55 69 N/A INTRINSIC
Pfam:TSSC4 90 210 1.7e-34 PFAM
low complexity region 232 250 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential (TRP) protein family, which is a diverse group of proteins with structural features typical of ion channels. This protein plays an important role in taste transduction, and has characteristics of a calcium-activated, non-selective cation channel that carries Na+, K+, and Cs+ ions equally well, but not Ca(2+) ions. It is activated by lower concentrations of intracellular Ca(2+), and inhibited by higher concentrations. It is also a highly temperature-sensitive, heat activated channel showing a steep increase of inward currents at temperatures between 15 and 35 degrees Celsius. This gene is located within the Beckwith-Wiedemann syndrome critical region-1 on chromosome 11p15.5, and has been shown to be imprinted, with exclusive expression from the paternal allele. [provided by RefSeq, Oct 2010]
PHENOTYPE: Homozygous mutant mice demonstrate abnormal taste perception, responding to sour and salty stimuli but not to sweet, or bitter stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,329,329 I6N possibly damaging Het
Aen T C 7: 78,905,868 V188A probably damaging Het
Afg3l1 A G 8: 123,501,954 E753G probably damaging Het
Alas1 G A 9: 106,238,660 T385I probably damaging Het
Alms1 C A 6: 85,667,963 probably benign Het
Ankrd65 A G 4: 155,791,411 T30A possibly damaging Het
App T C 16: 84,978,229 S582G probably damaging Het
Arfgef1 A T 1: 10,153,654 V1473E possibly damaging Het
Arhgap21 G A 2: 20,854,998 P1196S probably damaging Het
Arhgap24 A G 5: 102,891,910 T238A probably benign Het
Atf7 T C 15: 102,529,004 probably benign Het
Best1 G T 19: 9,993,311 S55* probably null Het
Capn11 A G 17: 45,633,799 V514A probably damaging Het
Cep104 T A 4: 153,989,146 M52K probably damaging Het
Clca3a1 C T 3: 144,737,858 probably null Het
Cyp3a25 T C 5: 146,003,027 probably null Het
Dmxl2 G A 9: 54,400,094 P2197S probably damaging Het
Drosha T C 15: 12,859,465 probably null Het
Exosc9 A G 3: 36,563,162 K355R probably benign Het
Fut1 A C 7: 45,619,198 H192P probably benign Het
Gm572 T A 4: 148,664,384 V166D possibly damaging Het
Gm9966 C T 7: 95,958,528 P19S unknown Het
Gmds C T 13: 32,100,473 V219I probably damaging Het
Gsn G A 2: 35,283,953 E25K probably benign Het
Il4i1 T C 7: 44,839,891 F368S probably damaging Het
Irak1bp1 T C 9: 82,830,320 L98P probably damaging Het
Khdrbs3 T C 15: 69,024,695 probably benign Het
Kndc1 T C 7: 139,921,822 I925T probably damaging Het
Laptm4a T C 12: 8,938,151 I296T probably benign Het
Lpl A T 8: 68,887,518 H55L probably benign Het
Lrrk2 C A 15: 91,755,927 N1558K probably benign Het
Mfsd2a A G 4: 122,950,487 L289P probably damaging Het
Mmrn2 T A 14: 34,398,802 M543K probably benign Het
Mnat1 T C 12: 73,181,776 probably benign Het
Msto1 A T 3: 88,911,893 probably null Het
Mtus1 A G 8: 41,082,739 Y647H probably damaging Het
Nars A T 18: 64,505,016 V289E probably damaging Het
Oit3 T A 10: 59,428,345 K322N probably damaging Het
Oit3 G A 10: 59,441,685 probably benign Het
Olfr1024 A G 2: 85,904,556 I166T probably benign Het
Olfr1467 T A 19: 13,365,193 C188* probably null Het
Olfr728 T C 14: 50,139,983 I219V probably benign Het
Olfr801 G A 10: 129,670,286 R78W probably damaging Het
Pecr A T 1: 72,277,310 C79S probably damaging Het
Plekhn1 T C 4: 156,222,659 D478G probably damaging Het
Pls1 A T 9: 95,776,563 M264K probably benign Het
Ptprj C A 2: 90,474,996 probably benign Het
Pygm A G 19: 6,397,601 D646G probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scn8a T C 15: 100,969,162 V283A probably benign Het
Shisa5 T C 9: 109,056,507 probably null Het
Slc10a4 A G 5: 73,008,505 I246V possibly damaging Het
Slc1a1 A T 19: 28,892,912 I104F probably benign Het
Slc22a8 A G 19: 8,610,195 Y511C probably benign Het
Slc6a5 A G 7: 49,956,462 N706S probably benign Het
Sos2 T C 12: 69,650,659 K96E probably damaging Het
Stom G A 2: 35,315,965 R251* probably null Het
Sycp1 T C 3: 102,845,066 E800G probably benign Het
Tab2 G A 10: 7,907,481 P679L probably damaging Het
Tiam2 G A 17: 3,453,382 V945I probably damaging Het
Uchl1 T G 5: 66,682,613 I139S probably damaging Het
Vmn1r232 A G 17: 20,914,026 I104T possibly damaging Het
Vmn2r97 G A 17: 18,947,552 M689I probably benign Het
Zc3h18 A T 8: 122,403,165 probably benign Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp456 T C 13: 67,362,372 K99R probably benign Het
Other mutations in Trpm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Trpm5 APN 7 143082991 missense probably benign 0.03
IGL00717:Trpm5 APN 7 143073990 missense probably damaging 1.00
IGL01138:Trpm5 APN 7 143074569 missense probably benign
IGL01590:Trpm5 APN 7 143082734 missense probably damaging 0.99
IGL01603:Trpm5 APN 7 143075601 missense probably benign 0.04
IGL01685:Trpm5 APN 7 143082354 missense probably benign 0.05
IGL01878:Trpm5 APN 7 143074497 missense probably damaging 1.00
IGL02533:Trpm5 APN 7 143089545 missense probably benign 0.01
IGL02572:Trpm5 APN 7 143087876 splice site probably benign
IGL02750:Trpm5 APN 7 143074484 missense possibly damaging 0.89
IGL02862:Trpm5 APN 7 143082525 missense probably damaging 1.00
R0032:Trpm5 UTSW 7 143085241 missense probably damaging 1.00
R0238:Trpm5 UTSW 7 143082958 missense probably damaging 1.00
R0238:Trpm5 UTSW 7 143082958 missense probably damaging 1.00
R0239:Trpm5 UTSW 7 143082958 missense probably damaging 1.00
R0239:Trpm5 UTSW 7 143082958 missense probably damaging 1.00
R0334:Trpm5 UTSW 7 143086876 missense probably benign 0.06
R0799:Trpm5 UTSW 7 143078351 missense probably damaging 0.99
R1187:Trpm5 UTSW 7 143074469 missense probably damaging 0.96
R1373:Trpm5 UTSW 7 143086842 splice site probably benign
R1521:Trpm5 UTSW 7 143082889 missense probably benign 0.00
R1603:Trpm5 UTSW 7 143085209 missense probably benign 0.00
R1606:Trpm5 UTSW 7 143085171 nonsense probably null
R2009:Trpm5 UTSW 7 143087738 missense possibly damaging 0.58
R2437:Trpm5 UTSW 7 143082561 missense probably benign 0.03
R2508:Trpm5 UTSW 7 143088919 missense possibly damaging 0.80
R2985:Trpm5 UTSW 7 143082938 missense probably damaging 0.99
R3036:Trpm5 UTSW 7 143085463 missense probably benign 0.00
R3037:Trpm5 UTSW 7 143085463 missense probably benign 0.00
R3688:Trpm5 UTSW 7 143078456 missense probably damaging 0.98
R4156:Trpm5 UTSW 7 143089055 missense probably benign 0.04
R4734:Trpm5 UTSW 7 143082785 missense probably benign 0.04
R4811:Trpm5 UTSW 7 143080219 missense probably damaging 1.00
R4814:Trpm5 UTSW 7 143082636 missense possibly damaging 0.50
R4847:Trpm5 UTSW 7 143087763 missense possibly damaging 0.89
R5055:Trpm5 UTSW 7 143072784 missense probably benign 0.00
R5256:Trpm5 UTSW 7 143082303 missense probably damaging 1.00
R5413:Trpm5 UTSW 7 143080968 missense probably damaging 1.00
R5668:Trpm5 UTSW 7 143073229 missense probably benign 0.39
R6133:Trpm5 UTSW 7 143088951 missense probably damaging 0.98
R6242:Trpm5 UTSW 7 143073182 missense probably benign
R6564:Trpm5 UTSW 7 143072770 missense probably damaging 1.00
R6702:Trpm5 UTSW 7 143069318 unclassified probably benign
R6703:Trpm5 UTSW 7 143069318 unclassified probably benign
R6829:Trpm5 UTSW 7 143069429 unclassified probably benign
R6940:Trpm5 UTSW 7 143084810 nonsense probably null
R7337:Trpm5 UTSW 7 143089019 missense probably benign 0.01
R7513:Trpm5 UTSW 7 143081835 missense possibly damaging 0.84
R7560:Trpm5 UTSW 7 143080986 missense probably damaging 1.00
R7801:Trpm5 UTSW 7 143085241 missense probably damaging 1.00
R7961:Trpm5 UTSW 7 143080369 missense probably benign 0.00
R8009:Trpm5 UTSW 7 143080369 missense probably benign 0.00
R8189:Trpm5 UTSW 7 143081838 missense probably benign 0.32
R8441:Trpm5 UTSW 7 143072434 missense possibly damaging 0.75
R8507:Trpm5 UTSW 7 143078313 missense probably damaging 1.00
X0022:Trpm5 UTSW 7 143083042 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AACCCCAGTCCCTTCTATGG -3'
(R):5'- CTACCAACTGGATGCAATGGG -3'

Sequencing Primer
(F):5'- ATGGTCTCCTCTGTCAATTGGGAC -3'
(R):5'- CTGGATGCAATGGGGGATGAC -3'
Posted On2014-12-04