Incidental Mutation 'R2871:Msh2'
ID253798
Institutional Source Beutler Lab
Gene Symbol Msh2
Ensembl Gene ENSMUSG00000024151
Gene NamemutS homolog 2
Synonyms
MMRRC Submission 040459-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.828) question?
Stock #R2871 (G1)
Quality Score215
Status Not validated
Chromosome17
Chromosomal Location87672330-87723713 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 87685584 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 314 (Q314K)
Ref Sequence ENSEMBL: ENSMUSP00000024967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024967]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024967
AA Change: Q314K

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000024967
Gene: ENSMUSG00000024151
AA Change: Q314K

DomainStartEndE-ValueType
Pfam:MutS_I 17 132 4.6e-22 PFAM
Pfam:MutS_II 150 290 6.7e-23 PFAM
MUTSd 321 645 1e-105 SMART
MUTSac 662 849 3.54e-124 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172596
Predicted Effect probably benign
Transcript: ENSMUST00000172855
SMART Domains Protein: ENSMUSP00000133650
Gene: ENSMUSG00000024151

DomainStartEndE-ValueType
Pfam:MutS_I 13 129 3.8e-22 PFAM
Pfam:MutS_II 103 193 2.5e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173097
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.2%
  • 10x: 92.4%
  • 20x: 72.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus is frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). When cloned, it was discovered to be a human homolog of the E. coli mismatch repair gene mutS, consistent with the characteristic alterations in microsatellite sequences (RER+ phenotype) found in HNPCC. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a number of different targeted mutations develop lymphomas. In addition, depending on the allele, mutants may show intestinal adenocarcinomas and reduced class switch recombination or adenocarcinomas and abnormal mismatch repair or squamous cell carcinomas and skin tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,955,176 C811R possibly damaging Het
AI481877 A C 4: 59,093,850 L226R probably damaging Het
Akap8l G A 17: 32,338,442 T65I possibly damaging Het
Arid4a T A 12: 71,022,260 probably null Het
Armc2 C T 10: 41,966,700 probably null Het
Atp6v1g1 A G 4: 63,550,021 Y87C probably benign Het
Cfap54 A T 10: 92,921,419 F273I possibly damaging Het
Clasrp C A 7: 19,585,240 probably benign Het
Csmd2 T C 4: 128,557,718 F113S unknown Het
Cyp4a14 C A 4: 115,487,301 G456W probably damaging Het
Cyp4a30b A G 4: 115,458,362 H260R possibly damaging Het
Ddrgk1 T A 2: 130,664,644 probably benign Het
Dhx57 A T 17: 80,251,376 D1051E probably benign Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Eif4enif1 C T 11: 3,242,586 P805S probably damaging Het
Eml5 C T 12: 98,865,401 D433N probably damaging Het
Fan1 A G 7: 64,363,190 I668T probably benign Het
Frmpd4 A T X: 167,477,247 D1166E probably benign Het
Gm813 A T 16: 58,613,979 I125K probably benign Het
Gria2 G A 3: 80,702,492 T670I probably damaging Het
Grid2ip C A 5: 143,357,929 Q127K probably benign Het
Hdhd2 T C 18: 76,955,006 F44L probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hmcn1 A T 1: 150,738,716 V1313D possibly damaging Het
Ift172 C T 5: 31,257,861 V1335I probably benign Het
Ighv2-2 G A 12: 113,588,498 T40I possibly damaging Het
Kcnk10 T A 12: 98,434,813 R520S probably benign Het
Kif1c A G 11: 70,724,081 E567G probably damaging Het
Klf8 A T X: 153,382,682 E82D probably damaging Het
Kpna7 T C 5: 144,993,935 T367A probably benign Het
Lpo A G 11: 87,816,524 I221T possibly damaging Het
Lrrn3 T C 12: 41,452,723 I532V probably benign Het
Matr3 T A 18: 35,572,296 S91R probably benign Het
Mki67 G A 7: 135,708,149 P191L probably benign Het
Mlxip A G 5: 123,452,667 M878V probably benign Het
Mpp7 G A 18: 7,461,678 P65L possibly damaging Het
Mroh2a C A 1: 88,255,565 L1292I probably damaging Het
Mtor T A 4: 148,540,030 M2089K probably benign Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nlrp4b C T 7: 10,710,243 Q40* probably null Het
Nomo1 C A 7: 46,046,937 T293N probably damaging Het
Notum A G 11: 120,660,196 V48A probably benign Het
Npas3 C T 12: 54,068,013 R542* probably null Het
Olfr1101 A T 2: 86,988,848 C109* probably null Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Olfr45 A G 7: 140,691,285 I127V possibly damaging Het
Olfr71 C A 4: 43,706,458 V37L probably benign Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Pcdhga9 T A 18: 37,737,471 Y118N possibly damaging Het
Pes1 C A 11: 3,976,834 T372K probably benign Het
Pkp4 C A 2: 59,308,156 T250K probably benign Het
Plekhg5 T A 4: 152,107,503 C433S probably benign Het
Plin2 A G 4: 86,668,678 M1T probably null Het
Prdx4 A G X: 155,340,464 V15A probably benign Het
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Psmd13 A T 7: 140,887,055 T116S probably damaging Het
Rel T C 11: 23,761,129 I13V probably benign Het
Reln C T 5: 22,049,791 V527I possibly damaging Het
Rnf6 T C 5: 146,210,405 Y601C probably benign Het
Rps6kc1 T C 1: 190,899,569 I48M probably damaging Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Slc39a8 T A 3: 135,886,793 probably null Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
St5 A T 7: 109,557,430 Y38N probably benign Het
Tnni3k C T 3: 154,938,750 probably null Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vmn2r70 T A 7: 85,559,019 Y750F probably damaging Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Other mutations in Msh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01405:Msh2 APN 17 87678235 missense probably damaging 1.00
IGL01602:Msh2 APN 17 87696489 unclassified probably benign
IGL01605:Msh2 APN 17 87696489 unclassified probably benign
IGL01775:Msh2 APN 17 87682646 missense possibly damaging 0.94
IGL02243:Msh2 APN 17 87678368 splice site probably benign
IGL02524:Msh2 APN 17 87678357 missense probably benign 0.01
IGL02730:Msh2 APN 17 87707215 missense probably damaging 1.00
IGL02743:Msh2 APN 17 87707215 missense probably damaging 1.00
IGL03049:Msh2 APN 17 87708509 missense probably damaging 1.00
IGL03282:Msh2 APN 17 87689002 missense probably benign 0.00
IGL03286:Msh2 APN 17 87682667 missense possibly damaging 0.92
R0011:Msh2 UTSW 17 87680093 intron probably benign
R0363:Msh2 UTSW 17 87717476 missense probably benign 0.30
R0520:Msh2 UTSW 17 87717544 missense possibly damaging 0.77
R0633:Msh2 UTSW 17 87672810 splice site probably null
R0862:Msh2 UTSW 17 87680052 missense probably benign
R0864:Msh2 UTSW 17 87680052 missense probably benign
R1146:Msh2 UTSW 17 87680060 missense probably benign 0.00
R1146:Msh2 UTSW 17 87680060 missense probably benign 0.00
R1264:Msh2 UTSW 17 87707179 splice site probably null
R1459:Msh2 UTSW 17 87678343 missense probably benign 0.01
R1572:Msh2 UTSW 17 87718652 missense possibly damaging 0.89
R1592:Msh2 UTSW 17 87680013 splice site probably null
R1647:Msh2 UTSW 17 87672636 missense probably benign
R1984:Msh2 UTSW 17 87719296 missense probably damaging 1.00
R2298:Msh2 UTSW 17 87708502 missense probably damaging 0.99
R2871:Msh2 UTSW 17 87685584 missense possibly damaging 0.61
R4383:Msh2 UTSW 17 87689138 missense probably benign 0.00
R4411:Msh2 UTSW 17 87717604 missense probably damaging 0.97
R4589:Msh2 UTSW 17 87680032 missense possibly damaging 0.67
R4598:Msh2 UTSW 17 87708578 missense probably damaging 1.00
R4599:Msh2 UTSW 17 87708578 missense probably damaging 1.00
R4712:Msh2 UTSW 17 87678385 intron probably benign
R4714:Msh2 UTSW 17 87718789 missense probably damaging 1.00
R4834:Msh2 UTSW 17 87723413 missense probably benign
R4842:Msh2 UTSW 17 87723413 missense probably benign
R4859:Msh2 UTSW 17 87718759 missense possibly damaging 0.94
R5007:Msh2 UTSW 17 87723413 missense probably benign
R5008:Msh2 UTSW 17 87723413 missense probably benign
R5010:Msh2 UTSW 17 87723413 missense probably benign
R5014:Msh2 UTSW 17 87717576 missense possibly damaging 0.83
R5048:Msh2 UTSW 17 87672768 missense probably damaging 1.00
R5133:Msh2 UTSW 17 87723413 missense probably benign
R5162:Msh2 UTSW 17 87723413 missense probably benign
R5163:Msh2 UTSW 17 87723413 missense probably benign
R5183:Msh2 UTSW 17 87723413 missense probably benign
R5184:Msh2 UTSW 17 87723413 missense probably benign
R5597:Msh2 UTSW 17 87723361 missense probably benign 0.04
R5655:Msh2 UTSW 17 87719443 missense possibly damaging 0.82
R5973:Msh2 UTSW 17 87708583 missense probably damaging 1.00
R6191:Msh2 UTSW 17 87723472 missense probably benign 0.03
R6632:Msh2 UTSW 17 87712666 missense possibly damaging 0.49
R7260:Msh2 UTSW 17 87717619 missense probably damaging 0.97
R7358:Msh2 UTSW 17 87717529 missense possibly damaging 0.89
X0058:Msh2 UTSW 17 87679934 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGTATCTCGTCTTATGATTGAAG -3'
(R):5'- TCTGCTCCCAGTTACTGCAG -3'

Sequencing Primer
(F):5'- ATCTCGTCTTATGATTGAAGAATGAG -3'
(R):5'- CCAGTTACTGCAGTGTTTAACCAAAC -3'
Posted On2014-12-04