Incidental Mutation 'R2871:Matr3'
ID 253802
Institutional Source Beutler Lab
Gene Symbol Matr3
Ensembl Gene ENSMUSG00000037236
Gene Name matrin 3
Synonyms D030046F20Rik, 2810017I02Rik, 1110061A14Rik
MMRRC Submission 040459-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.959) question?
Stock # R2871 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 35695191-35726888 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 35705349 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 91 (S91R)
Ref Sequence ENSEMBL: ENSMUSP00000140846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166793] [ENSMUST00000186292] [ENSMUST00000186614] [ENSMUST00000186796] [ENSMUST00000187389] [ENSMUST00000187513] [ENSMUST00000187543] [ENSMUST00000187793] [ENSMUST00000188359] [ENSMUST00000190029] [ENSMUST00000190458] [ENSMUST00000190121] [ENSMUST00000189163] [ENSMUST00000190653] [ENSMUST00000188767] [ENSMUST00000188275] [ENSMUST00000189039]
AlphaFold Q8K310
Predicted Effect probably benign
Transcript: ENSMUST00000166793
AA Change: S91R

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000125761
Gene: ENSMUSG00000037236
AA Change: S91R

DomainStartEndE-ValueType
low complexity region 23 32 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
ZnF_U1 288 322 4.47e-6 SMART
ZnF_C2H2 291 315 2.12e1 SMART
low complexity region 351 361 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
RRM 399 469 7.74e-3 SMART
RRM 497 567 5.63e-9 SMART
low complexity region 650 675 N/A INTRINSIC
low complexity region 710 718 N/A INTRINSIC
ZnF_U1 797 832 1.87e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186292
SMART Domains Protein: ENSMUSP00000139437
Gene: ENSMUSG00000037236

DomainStartEndE-ValueType
low complexity region 23 32 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186295
Predicted Effect probably benign
Transcript: ENSMUST00000186614
AA Change: S91R

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000141189
Gene: ENSMUSG00000037236
AA Change: S91R

DomainStartEndE-ValueType
low complexity region 23 32 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
ZnF_U1 288 322 2.6e-8 SMART
ZnF_C2H2 291 315 8.8e-2 SMART
low complexity region 351 361 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186796
SMART Domains Protein: ENSMUSP00000140128
Gene: ENSMUSG00000037236

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
low complexity region 33 48 N/A INTRINSIC
RRM 61 131 3.2e-5 SMART
RRM 159 229 2.4e-11 SMART
low complexity region 312 337 N/A INTRINSIC
low complexity region 372 380 N/A INTRINSIC
ZnF_U1 459 494 1.1e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187389
AA Change: S91R

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000139745
Gene: ENSMUSG00000037236
AA Change: S91R

DomainStartEndE-ValueType
low complexity region 23 32 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
ZnF_U1 288 322 4.47e-6 SMART
ZnF_C2H2 291 315 2.12e1 SMART
low complexity region 351 361 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
RRM 399 469 7.74e-3 SMART
RRM 497 567 5.63e-9 SMART
low complexity region 650 675 N/A INTRINSIC
low complexity region 710 718 N/A INTRINSIC
ZnF_U1 797 832 1.87e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187513
SMART Domains Protein: ENSMUSP00000139875
Gene: ENSMUSG00000099703

DomainStartEndE-ValueType
low complexity region 23 32 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187543
Predicted Effect probably benign
Transcript: ENSMUST00000187793
SMART Domains Protein: ENSMUSP00000140047
Gene: ENSMUSG00000099703

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
SCOP:d1lvk_2 42 78 4e-3 SMART
PDB:1X4D|A 52 102 4e-30 PDB
Blast:RRM 61 102 1e-22 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187980
Predicted Effect probably benign
Transcript: ENSMUST00000188359
AA Change: S91R

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000140148
Gene: ENSMUSG00000037236
AA Change: S91R

DomainStartEndE-ValueType
low complexity region 23 32 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190029
AA Change: S91R

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000140846
Gene: ENSMUSG00000037236
AA Change: S91R

DomainStartEndE-ValueType
low complexity region 23 32 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
ZnF_U1 288 322 4.47e-6 SMART
ZnF_C2H2 291 315 2.12e1 SMART
low complexity region 351 361 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
RRM 399 469 7.74e-3 SMART
RRM 497 567 5.63e-9 SMART
low complexity region 650 675 N/A INTRINSIC
low complexity region 710 718 N/A INTRINSIC
ZnF_U1 797 832 1.87e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190570
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193225
Predicted Effect probably benign
Transcript: ENSMUST00000190458
SMART Domains Protein: ENSMUSP00000139922
Gene: ENSMUSG00000099703

DomainStartEndE-ValueType
low complexity region 23 32 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190121
SMART Domains Protein: ENSMUSP00000140853
Gene: ENSMUSG00000037236

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
low complexity region 33 48 N/A INTRINSIC
RRM 61 131 3.2e-5 SMART
RRM 159 229 2.4e-11 SMART
low complexity region 312 337 N/A INTRINSIC
low complexity region 372 380 N/A INTRINSIC
ZnF_U1 459 494 1.1e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189163
Predicted Effect probably benign
Transcript: ENSMUST00000190653
SMART Domains Protein: ENSMUSP00000141135
Gene: ENSMUSG00000037236

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
low complexity region 33 48 N/A INTRINSIC
RRM 61 131 3.2e-5 SMART
RRM 159 229 2.4e-11 SMART
low complexity region 312 337 N/A INTRINSIC
low complexity region 372 380 N/A INTRINSIC
ZnF_U1 459 494 1.1e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188767
SMART Domains Protein: ENSMUSP00000141027
Gene: ENSMUSG00000037236

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
low complexity region 33 48 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188275
SMART Domains Protein: ENSMUSP00000140401
Gene: ENSMUSG00000037236

DomainStartEndE-ValueType
low complexity region 63 73 N/A INTRINSIC
low complexity region 83 98 N/A INTRINSIC
RRM 111 181 3.2e-5 SMART
RRM 209 279 2.4e-11 SMART
low complexity region 362 387 N/A INTRINSIC
low complexity region 422 430 N/A INTRINSIC
ZnF_U1 509 544 1.1e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189039
SMART Domains Protein: ENSMUSP00000139525
Gene: ENSMUSG00000037236

DomainStartEndE-ValueType
ZnF_U1 36 70 2.6e-8 SMART
ZnF_C2H2 39 63 8.8e-2 SMART
low complexity region 99 109 N/A INTRINSIC
Meta Mutation Damage Score 0.0671 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.2%
  • 10x: 92.4%
  • 20x: 72.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear matrix protein, which is proposed to stabilize certain messenger RNA species. Mutations of this gene are associated with distal myopathy 2, which often includes vocal cord and pharyngeal weakness. Alternatively spliced transcript variants, including read-through transcripts composed of the upstream small nucleolar RNA host gene 4 (non-protein coding) and matrin 3 gene sequence, have been identified. Pseudogenes of this gene are located on chromosomes 1 and X. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a gene-trapped allele are early embryonic lethal. Heterozygotes show congenital heart defects including abnormal heart apex morphology, subaortic ventricular septal defects, double-outlet right ventricle, bicuspid aortic valve, aorta coarctation, and patent ductus arteriosus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,846,002 (GRCm39) C811R possibly damaging Het
Akap8l G A 17: 32,557,416 (GRCm39) T65I possibly damaging Het
Arid4a T A 12: 71,069,034 (GRCm39) probably null Het
Armc2 C T 10: 41,842,696 (GRCm39) probably null Het
Atp6v1g1 A G 4: 63,468,258 (GRCm39) Y87C probably benign Het
Cfap54 A T 10: 92,757,281 (GRCm39) F273I possibly damaging Het
Clasrp C A 7: 19,319,165 (GRCm39) probably benign Het
Csmd2 T C 4: 128,451,511 (GRCm39) F113S unknown Het
Cyp4a14 C A 4: 115,344,498 (GRCm39) G456W probably damaging Het
Cyp4a30b A G 4: 115,315,559 (GRCm39) H260R possibly damaging Het
Ddrgk1 T A 2: 130,506,564 (GRCm39) probably benign Het
Dennd2b A T 7: 109,156,637 (GRCm39) Y38N probably benign Het
Dhx57 A T 17: 80,558,805 (GRCm39) D1051E probably benign Het
Eef2 GCCC GCCCC 10: 81,014,601 (GRCm39) probably null Het
Eif4enif1 C T 11: 3,192,586 (GRCm39) P805S probably damaging Het
Eml5 C T 12: 98,831,660 (GRCm39) D433N probably damaging Het
Fan1 A G 7: 64,012,938 (GRCm39) I668T probably benign Het
Frmpd4 A T X: 166,260,243 (GRCm39) D1166E probably benign Het
Ftdc1 A T 16: 58,434,342 (GRCm39) I125K probably benign Het
Gria2 G A 3: 80,609,799 (GRCm39) T670I probably damaging Het
Grid2ip C A 5: 143,343,684 (GRCm39) Q127K probably benign Het
Hdhd2 T C 18: 77,042,702 (GRCm39) F44L probably damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hmcn1 A T 1: 150,614,467 (GRCm39) V1313D possibly damaging Het
Ift172 C T 5: 31,415,205 (GRCm39) V1335I probably benign Het
Ighv2-2 G A 12: 113,552,118 (GRCm39) T40I possibly damaging Het
Kcnk10 T A 12: 98,401,072 (GRCm39) R520S probably benign Het
Kif1c A G 11: 70,614,907 (GRCm39) E567G probably damaging Het
Klf8 A T X: 152,165,678 (GRCm39) E82D probably damaging Het
Kpna7 T C 5: 144,930,745 (GRCm39) T367A probably benign Het
Lpo A G 11: 87,707,350 (GRCm39) I221T possibly damaging Het
Lrrn3 T C 12: 41,502,722 (GRCm39) I532V probably benign Het
Mki67 G A 7: 135,309,878 (GRCm39) P191L probably benign Het
Mlxip A G 5: 123,590,730 (GRCm39) M878V probably benign Het
Mpp7 G A 18: 7,461,678 (GRCm39) P65L possibly damaging Het
Mroh2a C A 1: 88,183,287 (GRCm39) L1292I probably damaging Het
Msh2 C A 17: 87,993,012 (GRCm39) Q314K possibly damaging Het
Mtor T A 4: 148,624,487 (GRCm39) M2089K probably benign Het
Myo9b G A 8: 71,786,981 (GRCm39) R721Q probably benign Het
Nlrp4b C T 7: 10,444,170 (GRCm39) Q40* probably null Het
Nomo1 C A 7: 45,696,361 (GRCm39) T293N probably damaging Het
Notum A G 11: 120,551,022 (GRCm39) V48A probably benign Het
Npas3 C T 12: 54,114,796 (GRCm39) R542* probably null Het
Or10z1 T C 1: 174,078,092 (GRCm39) S134G probably benign Het
Or13a17 A G 7: 140,271,198 (GRCm39) I127V possibly damaging Het
Or13j1 C A 4: 43,706,458 (GRCm39) V37L probably benign Het
Or5t16 A T 2: 86,819,192 (GRCm39) C109* probably null Het
Ostc T C 3: 130,497,157 (GRCm39) N80S probably damaging Het
Palmd T C 3: 116,717,400 (GRCm39) R366G possibly damaging Het
Parp1 A G 1: 180,401,230 (GRCm39) D45G probably damaging Het
Pcdhga9 T A 18: 37,870,524 (GRCm39) Y118N possibly damaging Het
Pes1 C A 11: 3,926,834 (GRCm39) T372K probably benign Het
Pkp4 C A 2: 59,138,500 (GRCm39) T250K probably benign Het
Plekhg5 T A 4: 152,191,960 (GRCm39) C433S probably benign Het
Plin2 A G 4: 86,586,915 (GRCm39) M1T probably null Het
Prdx4 A G X: 154,123,460 (GRCm39) V15A probably benign Het
Psmb8 T C 17: 34,419,144 (GRCm39) I146T probably damaging Het
Psmd13 A T 7: 140,466,968 (GRCm39) T116S probably damaging Het
Rel T C 11: 23,711,129 (GRCm39) I13V probably benign Het
Reln C T 5: 22,254,789 (GRCm39) V527I possibly damaging Het
Rnf6 T C 5: 146,147,215 (GRCm39) Y601C probably benign Het
Rps6kc1 T C 1: 190,631,766 (GRCm39) I48M probably damaging Het
Sfi1 CCTCTC CCTCTCTC 11: 3,127,419 (GRCm39) probably benign Het
Shoc1 A C 4: 59,093,850 (GRCm39) L226R probably damaging Het
Slc39a8 T A 3: 135,592,554 (GRCm39) probably null Het
Sppl2c C T 11: 104,078,141 (GRCm39) P314S probably benign Het
Tnni3k C T 3: 154,644,387 (GRCm39) probably null Het
Ugt1a1 AT A 1: 88,140,093 (GRCm39) probably null Het
Vmn2r68 A C 7: 84,882,834 (GRCm39) M306R probably benign Het
Vmn2r70 T A 7: 85,208,227 (GRCm39) Y750F probably damaging Het
Vwa7 G A 17: 35,240,218 (GRCm39) M395I probably damaging Het
Zfp53 A T 17: 21,728,340 (GRCm39) E124D probably benign Het
Other mutations in Matr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01396:Matr3 APN 18 35,721,442 (GRCm39) missense probably damaging 1.00
IGL03083:Matr3 APN 18 35,705,471 (GRCm39) missense probably damaging 0.96
IGL03117:Matr3 APN 18 35,705,710 (GRCm39) missense probably damaging 1.00
IGL03163:Matr3 APN 18 35,705,644 (GRCm39) missense probably damaging 0.99
IGL03381:Matr3 APN 18 35,712,078 (GRCm39) splice site probably benign
R0456:Matr3 UTSW 18 35,705,917 (GRCm39) missense probably damaging 1.00
R1136:Matr3 UTSW 18 35,705,948 (GRCm39) missense probably damaging 1.00
R1459:Matr3 UTSW 18 35,717,709 (GRCm39) missense probably benign 0.28
R1850:Matr3 UTSW 18 35,715,110 (GRCm39) missense probably damaging 1.00
R1929:Matr3 UTSW 18 35,721,378 (GRCm39) splice site probably benign
R2185:Matr3 UTSW 18 35,714,278 (GRCm39) missense probably damaging 1.00
R2366:Matr3 UTSW 18 35,721,448 (GRCm39) missense probably damaging 1.00
R2870:Matr3 UTSW 18 35,705,349 (GRCm39) missense probably benign 0.25
R2870:Matr3 UTSW 18 35,705,349 (GRCm39) missense probably benign 0.25
R2871:Matr3 UTSW 18 35,705,349 (GRCm39) missense probably benign 0.25
R2872:Matr3 UTSW 18 35,705,349 (GRCm39) missense probably benign 0.25
R2872:Matr3 UTSW 18 35,705,349 (GRCm39) missense probably benign 0.25
R2873:Matr3 UTSW 18 35,705,349 (GRCm39) missense probably benign 0.25
R3908:Matr3 UTSW 18 35,705,894 (GRCm39) missense probably damaging 1.00
R4400:Matr3 UTSW 18 35,716,969 (GRCm39) missense possibly damaging 0.80
R4417:Matr3 UTSW 18 35,705,171 (GRCm39) missense probably damaging 1.00
R4860:Matr3 UTSW 18 35,714,693 (GRCm39) missense probably damaging 1.00
R4860:Matr3 UTSW 18 35,714,693 (GRCm39) missense probably damaging 1.00
R4881:Matr3 UTSW 18 35,705,428 (GRCm39) missense probably damaging 1.00
R4908:Matr3 UTSW 18 35,705,754 (GRCm39) missense probably damaging 0.96
R5084:Matr3 UTSW 18 35,715,135 (GRCm39) missense probably damaging 0.99
R5660:Matr3 UTSW 18 35,705,147 (GRCm39) missense probably damaging 0.99
R5709:Matr3 UTSW 18 35,715,015 (GRCm39) missense probably damaging 1.00
R5779:Matr3 UTSW 18 35,717,575 (GRCm39) missense possibly damaging 0.81
R5876:Matr3 UTSW 18 35,720,791 (GRCm39) missense probably benign
R6392:Matr3 UTSW 18 35,717,894 (GRCm39) missense probably benign 0.07
R7062:Matr3 UTSW 18 35,712,072 (GRCm39) critical splice donor site probably null
R7156:Matr3 UTSW 18 35,705,974 (GRCm39) missense probably damaging 0.98
R7228:Matr3 UTSW 18 35,695,537 (GRCm39) missense unknown
R7389:Matr3 UTSW 18 35,717,638 (GRCm39) missense probably benign
R8940:Matr3 UTSW 18 35,705,640 (GRCm39) missense probably damaging 0.98
R9071:Matr3 UTSW 18 35,705,803 (GRCm39) missense possibly damaging 0.94
R9159:Matr3 UTSW 18 35,712,355 (GRCm39) missense possibly damaging 0.71
R9205:Matr3 UTSW 18 35,720,774 (GRCm39) missense probably benign 0.08
R9587:Matr3 UTSW 18 35,717,876 (GRCm39) missense probably null 0.13
Predicted Primers PCR Primer
(F):5'- ATAGGCCTTCTTGCTGCTGC -3'
(R):5'- CATAACTCAATGTAGGGCCTTCTTC -3'

Sequencing Primer
(F):5'- GCTACCCAGTCTTTAAGTATGCCAG -3'
(R):5'- AATGTAGGGCCTTCTTCAGTTC -3'
Posted On 2014-12-04