Incidental Mutation 'R2871:Hdhd2'
ID253803
Institutional Source Beutler Lab
Gene Symbol Hdhd2
Ensembl Gene ENSMUSG00000025421
Gene Namehaloacid dehalogenase-like hydrolase domain containing 2
Synonyms0610039H12Rik, 3110052N05Rik
MMRRC Submission 040459-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2871 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location76930126-76972902 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76955006 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 44 (F44L)
Ref Sequence ENSEMBL: ENSMUSP00000116152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026485] [ENSMUST00000097521] [ENSMUST00000097522] [ENSMUST00000142456] [ENSMUST00000143910] [ENSMUST00000145634] [ENSMUST00000147332] [ENSMUST00000148955] [ENSMUST00000150990] [ENSMUST00000156454]
Predicted Effect probably damaging
Transcript: ENSMUST00000026485
AA Change: F44L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000026485
Gene: ENSMUSG00000025421
AA Change: F44L

DomainStartEndE-ValueType
Pfam:Hydrolase_6 10 193 1.1e-21 PFAM
Pfam:HAD_2 167 223 1e-7 PFAM
Pfam:Hydrolase_like 176 251 3.4e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097521
AA Change: F44L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000095128
Gene: ENSMUSG00000025421
AA Change: F44L

DomainStartEndE-ValueType
Pfam:Hydrolase_6 10 123 4.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097522
AA Change: F44L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000095129
Gene: ENSMUSG00000025421
AA Change: F44L

DomainStartEndE-ValueType
Pfam:Hydrolase_6 10 193 1.4e-21 PFAM
Pfam:HAD_2 161 223 1.1e-7 PFAM
Pfam:Hydrolase_like 176 251 1.3e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142456
SMART Domains Protein: ENSMUSP00000118504
Gene: ENSMUSG00000025421

DomainStartEndE-ValueType
Pfam:Yos1 5 66 4.8e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000143910
AA Change: F44L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118678
Gene: ENSMUSG00000025421
AA Change: F44L

DomainStartEndE-ValueType
Pfam:Hydrolase_6 10 116 2.5e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000145634
AA Change: F44L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000123320
Gene: ENSMUSG00000025421
AA Change: F44L

DomainStartEndE-ValueType
Pfam:Hydrolase_6 10 193 1.4e-21 PFAM
Pfam:HAD_2 161 223 1.1e-7 PFAM
Pfam:Hydrolase_like 176 251 1.3e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000147332
AA Change: F44L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116152
Gene: ENSMUSG00000025421
AA Change: F44L

DomainStartEndE-ValueType
Pfam:Hydrolase_6 10 123 4.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000148955
AA Change: F44L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000116243
Gene: ENSMUSG00000025421
AA Change: F44L

DomainStartEndE-ValueType
Pfam:Hydrolase_6 10 193 1.4e-21 PFAM
Pfam:HAD_2 161 223 1.1e-7 PFAM
Pfam:Hydrolase_like 176 251 1.3e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000150990
AA Change: F44L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000114212
Gene: ENSMUSG00000025421
AA Change: F44L

DomainStartEndE-ValueType
Pfam:Hydrolase_6 10 193 1.4e-21 PFAM
Pfam:HAD_2 161 223 1.1e-7 PFAM
Pfam:Hydrolase_like 176 251 1.3e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000156454
AA Change: F44L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123035
Gene: ENSMUSG00000025421
AA Change: F44L

DomainStartEndE-ValueType
Pfam:Hydrolase_6 10 60 1.6e-13 PFAM
Meta Mutation Damage Score 0.7251 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.2%
  • 10x: 92.4%
  • 20x: 72.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a transposon insertion results in complete embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,955,176 C811R possibly damaging Het
AI481877 A C 4: 59,093,850 L226R probably damaging Het
Akap8l G A 17: 32,338,442 T65I possibly damaging Het
Arid4a T A 12: 71,022,260 probably null Het
Armc2 C T 10: 41,966,700 probably null Het
Atp6v1g1 A G 4: 63,550,021 Y87C probably benign Het
Cfap54 A T 10: 92,921,419 F273I possibly damaging Het
Clasrp C A 7: 19,585,240 probably benign Het
Csmd2 T C 4: 128,557,718 F113S unknown Het
Cyp4a14 C A 4: 115,487,301 G456W probably damaging Het
Cyp4a30b A G 4: 115,458,362 H260R possibly damaging Het
Ddrgk1 T A 2: 130,664,644 probably benign Het
Dhx57 A T 17: 80,251,376 D1051E probably benign Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Eif4enif1 C T 11: 3,242,586 P805S probably damaging Het
Eml5 C T 12: 98,865,401 D433N probably damaging Het
Fan1 A G 7: 64,363,190 I668T probably benign Het
Frmpd4 A T X: 167,477,247 D1166E probably benign Het
Gm813 A T 16: 58,613,979 I125K probably benign Het
Gria2 G A 3: 80,702,492 T670I probably damaging Het
Grid2ip C A 5: 143,357,929 Q127K probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hmcn1 A T 1: 150,738,716 V1313D possibly damaging Het
Ift172 C T 5: 31,257,861 V1335I probably benign Het
Ighv2-2 G A 12: 113,588,498 T40I possibly damaging Het
Kcnk10 T A 12: 98,434,813 R520S probably benign Het
Kif1c A G 11: 70,724,081 E567G probably damaging Het
Klf8 A T X: 153,382,682 E82D probably damaging Het
Kpna7 T C 5: 144,993,935 T367A probably benign Het
Lpo A G 11: 87,816,524 I221T possibly damaging Het
Lrrn3 T C 12: 41,452,723 I532V probably benign Het
Matr3 T A 18: 35,572,296 S91R probably benign Het
Mki67 G A 7: 135,708,149 P191L probably benign Het
Mlxip A G 5: 123,452,667 M878V probably benign Het
Mpp7 G A 18: 7,461,678 P65L possibly damaging Het
Mroh2a C A 1: 88,255,565 L1292I probably damaging Het
Msh2 C A 17: 87,685,584 Q314K possibly damaging Het
Mtor T A 4: 148,540,030 M2089K probably benign Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nlrp4b C T 7: 10,710,243 Q40* probably null Het
Nomo1 C A 7: 46,046,937 T293N probably damaging Het
Notum A G 11: 120,660,196 V48A probably benign Het
Npas3 C T 12: 54,068,013 R542* probably null Het
Olfr1101 A T 2: 86,988,848 C109* probably null Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Olfr45 A G 7: 140,691,285 I127V possibly damaging Het
Olfr71 C A 4: 43,706,458 V37L probably benign Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Pcdhga9 T A 18: 37,737,471 Y118N possibly damaging Het
Pes1 C A 11: 3,976,834 T372K probably benign Het
Pkp4 C A 2: 59,308,156 T250K probably benign Het
Plekhg5 T A 4: 152,107,503 C433S probably benign Het
Plin2 A G 4: 86,668,678 M1T probably null Het
Prdx4 A G X: 155,340,464 V15A probably benign Het
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Psmd13 A T 7: 140,887,055 T116S probably damaging Het
Rel T C 11: 23,761,129 I13V probably benign Het
Reln C T 5: 22,049,791 V527I possibly damaging Het
Rnf6 T C 5: 146,210,405 Y601C probably benign Het
Rps6kc1 T C 1: 190,899,569 I48M probably damaging Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Slc39a8 T A 3: 135,886,793 probably null Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
St5 A T 7: 109,557,430 Y38N probably benign Het
Tnni3k C T 3: 154,938,750 probably null Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vmn2r70 T A 7: 85,559,019 Y750F probably damaging Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Other mutations in Hdhd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Hdhd2 APN 18 76965273 splice site probably null
IGL01102:Hdhd2 APN 18 76956911 missense probably damaging 1.00
R0021:Hdhd2 UTSW 18 76970615 missense probably damaging 1.00
R0021:Hdhd2 UTSW 18 76970615 missense probably damaging 1.00
R0717:Hdhd2 UTSW 18 76951204 missense possibly damaging 0.94
R1958:Hdhd2 UTSW 18 76965145 missense probably benign
R2060:Hdhd2 UTSW 18 76965042 splice site probably null
R2266:Hdhd2 UTSW 18 76965170 missense probably benign 0.00
R2268:Hdhd2 UTSW 18 76965170 missense probably benign 0.00
R2269:Hdhd2 UTSW 18 76965170 missense probably benign 0.00
R2871:Hdhd2 UTSW 18 76955006 missense probably damaging 1.00
R2872:Hdhd2 UTSW 18 76955006 missense probably damaging 1.00
R2872:Hdhd2 UTSW 18 76955006 missense probably damaging 1.00
R2873:Hdhd2 UTSW 18 76955006 missense probably damaging 1.00
R3788:Hdhd2 UTSW 18 76955187 critical splice donor site probably null
R3789:Hdhd2 UTSW 18 76955187 critical splice donor site probably null
R5784:Hdhd2 UTSW 18 76967145 missense probably damaging 1.00
R7403:Hdhd2 UTSW 18 76955040 missense probably benign 0.00
R7406:Hdhd2 UTSW 18 76944115 missense probably benign 0.01
R7644:Hdhd2 UTSW 18 76944175 missense possibly damaging 0.79
R7849:Hdhd2 UTSW 18 76965266 missense probably damaging 1.00
R7932:Hdhd2 UTSW 18 76965266 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTTTCCAGTGTGGGAGAC -3'
(R):5'- AGAACTTGGTCAACTTCTCCC -3'

Sequencing Primer
(F):5'- TGGGAGACACTGCCCAC -3'
(R):5'- CCTGTGAACTCAGGCAGTG -3'
Posted On2014-12-04