Incidental Mutation 'R2516:Alas1'
ID253815
Institutional Source Beutler Lab
Gene Symbol Alas1
Ensembl Gene ENSMUSG00000032786
Gene Nameaminolevulinic acid synthase 1
Synonymssuccinyl-CoA: glycine C-succinyl transferase, Alas-1, ALAS-N, 5-aminolevulinate synthase
MMRRC Submission 040420-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2516 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location106233455-106248654 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 106238660 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 385 (T385I)
Ref Sequence ENSEMBL: ENSMUSP00000117014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074082] [ENSMUST00000112524] [ENSMUST00000133617] [ENSMUST00000141118] [ENSMUST00000143125] [ENSMUST00000214989] [ENSMUST00000215222] [ENSMUST00000219129]
Predicted Effect probably damaging
Transcript: ENSMUST00000074082
AA Change: T385I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073725
Gene: ENSMUSG00000032786
AA Change: T385I

DomainStartEndE-ValueType
Pfam:Preseq_ALAS 1 81 1.1e-21 PFAM
Pfam:Preseq_ALAS 73 141 2.8e-12 PFAM
Pfam:Aminotran_1_2 245 591 2.1e-77 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112524
AA Change: T385I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108143
Gene: ENSMUSG00000032786
AA Change: T385I

DomainStartEndE-ValueType
Pfam:Preseq_ALAS 2 140 1.3e-49 PFAM
Pfam:Aminotran_1_2 245 592 5.3e-80 PFAM
Pfam:Cys_Met_Meta_PP 283 423 1.5e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123601
Predicted Effect probably benign
Transcript: ENSMUST00000133617
SMART Domains Protein: ENSMUSP00000122117
Gene: ENSMUSG00000032786

DomainStartEndE-ValueType
Pfam:Preseq_ALAS 1 79 3.1e-22 PFAM
Pfam:Preseq_ALAS 73 141 8.7e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134053
Predicted Effect probably damaging
Transcript: ENSMUST00000141118
AA Change: T385I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117014
Gene: ENSMUSG00000032786
AA Change: T385I

DomainStartEndE-ValueType
Pfam:Preseq_ALAS 1 81 1.7e-20 PFAM
Pfam:Preseq_ALAS 73 141 4.2e-11 PFAM
Pfam:Aminotran_1_2 245 592 5.3e-80 PFAM
Pfam:Aminotran_5 257 422 3.4e-6 PFAM
Pfam:Cys_Met_Meta_PP 285 423 1.8e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000143125
AA Change: T24I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119968
Gene: ENSMUSG00000032786
AA Change: T24I

DomainStartEndE-ValueType
Pfam:Aminotran_5 1 61 7.7e-7 PFAM
Pfam:Aminotran_1_2 1 93 2.2e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214249
Predicted Effect probably damaging
Transcript: ENSMUST00000214989
AA Change: T34I

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000215222
Predicted Effect probably benign
Transcript: ENSMUST00000219129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219340
Meta Mutation Damage Score 0.8460 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the mitochondrial enzyme which is catalyzes the rate-limiting step in heme (iron-protoporphyrin) biosynthesis. The enzyme encoded by this gene is the housekeeping enzyme; a separate gene encodes a form of the enzyme that is specific for erythroid tissue. The level of the mature encoded protein is regulated by heme: high levels of heme down-regulate the mature enzyme in mitochondria while low heme levels up-regulate. A pseudogene of this gene is located on chromosome 12. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a reporter allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,329,329 I6N possibly damaging Het
Aen T C 7: 78,905,868 V188A probably damaging Het
Afg3l1 A G 8: 123,501,954 E753G probably damaging Het
Alms1 C A 6: 85,667,963 probably benign Het
Ankrd65 A G 4: 155,791,411 T30A possibly damaging Het
App T C 16: 84,978,229 S582G probably damaging Het
Arfgef1 A T 1: 10,153,654 V1473E possibly damaging Het
Arhgap21 G A 2: 20,854,998 P1196S probably damaging Het
Arhgap24 A G 5: 102,891,910 T238A probably benign Het
Atf7 T C 15: 102,529,004 probably benign Het
Best1 G T 19: 9,993,311 S55* probably null Het
Capn11 A G 17: 45,633,799 V514A probably damaging Het
Cep104 T A 4: 153,989,146 M52K probably damaging Het
Clca3a1 C T 3: 144,737,858 probably null Het
Cyp3a25 T C 5: 146,003,027 probably null Het
Dmxl2 G A 9: 54,400,094 P2197S probably damaging Het
Drosha T C 15: 12,859,465 probably null Het
Exosc9 A G 3: 36,563,162 K355R probably benign Het
Fut1 A C 7: 45,619,198 H192P probably benign Het
Gm572 T A 4: 148,664,384 V166D possibly damaging Het
Gm9966 C T 7: 95,958,528 P19S unknown Het
Gmds C T 13: 32,100,473 V219I probably damaging Het
Gsn G A 2: 35,283,953 E25K probably benign Het
Il4i1 T C 7: 44,839,891 F368S probably damaging Het
Irak1bp1 T C 9: 82,830,320 L98P probably damaging Het
Khdrbs3 T C 15: 69,024,695 probably benign Het
Kndc1 T C 7: 139,921,822 I925T probably damaging Het
Laptm4a T C 12: 8,938,151 I296T probably benign Het
Lpl A T 8: 68,887,518 H55L probably benign Het
Lrrk2 C A 15: 91,755,927 N1558K probably benign Het
Mfsd2a A G 4: 122,950,487 L289P probably damaging Het
Mmrn2 T A 14: 34,398,802 M543K probably benign Het
Mnat1 T C 12: 73,181,776 probably benign Het
Msto1 A T 3: 88,911,893 probably null Het
Mtus1 A G 8: 41,082,739 Y647H probably damaging Het
Nars A T 18: 64,505,016 V289E probably damaging Het
Oit3 T A 10: 59,428,345 K322N probably damaging Het
Oit3 G A 10: 59,441,685 probably benign Het
Olfr1024 A G 2: 85,904,556 I166T probably benign Het
Olfr1467 T A 19: 13,365,193 C188* probably null Het
Olfr728 T C 14: 50,139,983 I219V probably benign Het
Olfr801 G A 10: 129,670,286 R78W probably damaging Het
Pecr A T 1: 72,277,310 C79S probably damaging Het
Plekhn1 T C 4: 156,222,659 D478G probably damaging Het
Pls1 A T 9: 95,776,563 M264K probably benign Het
Ptprj C A 2: 90,474,996 probably benign Het
Pygm A G 19: 6,397,601 D646G probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scn8a T C 15: 100,969,162 V283A probably benign Het
Shisa5 T C 9: 109,056,507 probably null Het
Slc10a4 A G 5: 73,008,505 I246V possibly damaging Het
Slc1a1 A T 19: 28,892,912 I104F probably benign Het
Slc22a8 A G 19: 8,610,195 Y511C probably benign Het
Slc6a5 A G 7: 49,956,462 N706S probably benign Het
Sos2 T C 12: 69,650,659 K96E probably damaging Het
Stom G A 2: 35,315,965 R251* probably null Het
Sycp1 T C 3: 102,845,066 E800G probably benign Het
Tab2 G A 10: 7,907,481 P679L probably damaging Het
Tiam2 G A 17: 3,453,382 V945I probably damaging Het
Trpm5 G T 7: 143,074,517 P1007Q probably damaging Het
Uchl1 T G 5: 66,682,613 I139S probably damaging Het
Vmn1r232 A G 17: 20,914,026 I104T possibly damaging Het
Vmn2r97 G A 17: 18,947,552 M689I probably benign Het
Zc3h18 A T 8: 122,403,165 probably benign Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp456 T C 13: 67,362,372 K99R probably benign Het
Other mutations in Alas1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Alas1 APN 9 106236472 missense probably benign 0.17
IGL02165:Alas1 APN 9 106238783 missense probably damaging 1.00
IGL02355:Alas1 APN 9 106236639 missense probably damaging 1.00
IGL02362:Alas1 APN 9 106236639 missense probably damaging 1.00
IGL02499:Alas1 APN 9 106241321 missense probably damaging 1.00
IGL02606:Alas1 APN 9 106241110 unclassified probably benign
IGL03121:Alas1 APN 9 106246914 missense probably damaging 0.99
R0115:Alas1 UTSW 9 106238252 splice site probably null
R0294:Alas1 UTSW 9 106241256 missense probably damaging 1.00
R0333:Alas1 UTSW 9 106241281 missense probably benign 0.08
R0346:Alas1 UTSW 9 106243351 missense possibly damaging 0.78
R1700:Alas1 UTSW 9 106239646 missense possibly damaging 0.46
R1982:Alas1 UTSW 9 106238185 missense probably damaging 1.00
R2056:Alas1 UTSW 9 106241290 missense probably damaging 1.00
R2058:Alas1 UTSW 9 106241290 missense probably damaging 1.00
R2059:Alas1 UTSW 9 106241290 missense probably damaging 1.00
R2355:Alas1 UTSW 9 106236474 missense probably damaging 0.96
R3896:Alas1 UTSW 9 106241801 splice site probably null
R4091:Alas1 UTSW 9 106241801 splice site probably null
R4093:Alas1 UTSW 9 106241801 splice site probably null
R4095:Alas1 UTSW 9 106241801 splice site probably null
R4673:Alas1 UTSW 9 106236477 missense probably damaging 1.00
R4948:Alas1 UTSW 9 106246878 nonsense probably null
R5165:Alas1 UTSW 9 106241255 missense probably damaging 1.00
R5215:Alas1 UTSW 9 106243375 missense probably benign 0.05
R5420:Alas1 UTSW 9 106234159 missense probably benign 0.13
R5993:Alas1 UTSW 9 106234129 missense probably benign 0.11
R6033:Alas1 UTSW 9 106241204 missense probably damaging 1.00
R6033:Alas1 UTSW 9 106241204 missense probably damaging 1.00
R7489:Alas1 UTSW 9 106241634 critical splice donor site probably null
R7726:Alas1 UTSW 9 106246951 missense probably benign 0.00
R8012:Alas1 UTSW 9 106246763 missense probably benign
R8036:Alas1 UTSW 9 106235522 missense probably benign 0.19
R8353:Alas1 UTSW 9 106236522 missense possibly damaging 0.83
R8453:Alas1 UTSW 9 106236522 missense possibly damaging 0.83
Z1176:Alas1 UTSW 9 106238769 missense probably benign 0.42
Z1176:Alas1 UTSW 9 106243367 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTCAATTACAGAGTCCCAGTGC -3'
(R):5'- GCCTCTGCCATTAAGTAGCAC -3'

Sequencing Primer
(F):5'- AAAAATGCCAAACCAAAAGGAAAC -3'
(R):5'- AAGTAGCACTTTTCTCATGTCAGGC -3'
Posted On2014-12-04