Incidental Mutation 'R2516:Shisa5'
ID253817
Institutional Source Beutler Lab
Gene Symbol Shisa5
Ensembl Gene ENSMUSG00000025647
Gene Nameshisa family member 5
Synonyms2310008D10Rik, Scotin, 6430628I05Rik
MMRRC Submission 040420-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2516 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location109038565-109057777 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 109056507 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026737] [ENSMUST00000045011] [ENSMUST00000061973] [ENSMUST00000112053] [ENSMUST00000112059] [ENSMUST00000128062] [ENSMUST00000154184] [ENSMUST00000159614] [ENSMUST00000160217] [ENSMUST00000161521] [ENSMUST00000196954] [ENSMUST00000197099] [ENSMUST00000197483] [ENSMUST00000197689] [ENSMUST00000198295] [ENSMUST00000198376] [ENSMUST00000198708] [ENSMUST00000200515] [ENSMUST00000200629]
Predicted Effect probably null
Transcript: ENSMUST00000026737
SMART Domains Protein: ENSMUSP00000026737
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:Shisa 24 211 1.3e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045011
SMART Domains Protein: ENSMUSP00000044831
Gene: ENSMUSG00000025646

DomainStartEndE-ValueType
SCOP:d1eq1a_ 96 193 8e-3 SMART
low complexity region 326 338 N/A INTRINSIC
low complexity region 542 548 N/A INTRINSIC
low complexity region 555 566 N/A INTRINSIC
low complexity region 598 609 N/A INTRINSIC
low complexity region 761 779 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000061973
SMART Domains Protein: ENSMUSP00000050971
Gene: ENSMUSG00000049734

DomainStartEndE-ValueType
EXOIII 13 217 2.45e-13 SMART
low complexity region 248 283 N/A INTRINSIC
transmembrane domain 287 309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112053
SMART Domains Protein: ENSMUSP00000107684
Gene: ENSMUSG00000049734

DomainStartEndE-ValueType
EXOIII 13 217 2.45e-13 SMART
low complexity region 248 283 N/A INTRINSIC
transmembrane domain 287 309 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112059
SMART Domains Protein: ENSMUSP00000107690
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:Shisa 26 198 1.1e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128062
SMART Domains Protein: ENSMUSP00000118499
Gene: ENSMUSG00000025646

DomainStartEndE-ValueType
PDB:3MXJ|A 1 150 4e-97 PDB
SCOP:d1fxxa_ 12 146 7e-12 SMART
Blast:EXOIII 13 150 1e-85 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000154184
SMART Domains Protein: ENSMUSP00000128901
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 1 108 1.6e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159614
SMART Domains Protein: ENSMUSP00000124854
Gene: ENSMUSG00000025646

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 54 60 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
low complexity region 110 121 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160217
SMART Domains Protein: ENSMUSP00000125264
Gene: ENSMUSG00000025646

DomainStartEndE-ValueType
SCOP:d1eq1a_ 96 193 3e-3 SMART
low complexity region 326 338 N/A INTRINSIC
low complexity region 533 550 N/A INTRINSIC
low complexity region 570 581 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160928
SMART Domains Protein: ENSMUSP00000123837
Gene: ENSMUSG00000025646

DomainStartEndE-ValueType
SCOP:d1eq1a_ 19 116 9e-3 SMART
low complexity region 249 261 N/A INTRINSIC
low complexity region 465 471 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
low complexity region 521 532 N/A INTRINSIC
low complexity region 684 702 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161163
Predicted Effect probably benign
Transcript: ENSMUST00000161521
SMART Domains Protein: ENSMUSP00000125615
Gene: ENSMUSG00000025646

DomainStartEndE-ValueType
coiled coil region 108 208 N/A INTRINSIC
low complexity region 326 338 N/A INTRINSIC
low complexity region 542 548 N/A INTRINSIC
low complexity region 555 566 N/A INTRINSIC
low complexity region 598 609 N/A INTRINSIC
low complexity region 734 752 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000196954
SMART Domains Protein: ENSMUSP00000143599
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 1 95 1.9e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000197099
SMART Domains Protein: ENSMUSP00000143648
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 1 129 9.9e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197194
Predicted Effect probably null
Transcript: ENSMUST00000197483
SMART Domains Protein: ENSMUSP00000143613
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 1 95 1.9e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197689
SMART Domains Protein: ENSMUSP00000142874
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 1 63 4.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198295
SMART Domains Protein: ENSMUSP00000143721
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 1 70 1.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198376
SMART Domains Protein: ENSMUSP00000143374
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 1 83 5e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198639
Predicted Effect probably null
Transcript: ENSMUST00000198708
SMART Domains Protein: ENSMUSP00000142978
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 1 109 7.8e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199288
Predicted Effect probably null
Transcript: ENSMUST00000199868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200366
Predicted Effect probably null
Transcript: ENSMUST00000200515
SMART Domains Protein: ENSMUSP00000142835
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 11 147 4.1e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200629
SMART Domains Protein: ENSMUSP00000142404
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 1 72 1.9e-23 PFAM
Meta Mutation Damage Score 0.9492 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the shisa family. The encoded protein is localized to the endoplasmic reticulum, and together with p53 induces apoptosis in a caspase-dependent manner. Alternative splicing results in multiple transcript variants. Related pseudogenes of this gene are found on chromosome X. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and exhibit no apparent phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,329,329 I6N possibly damaging Het
Aen T C 7: 78,905,868 V188A probably damaging Het
Afg3l1 A G 8: 123,501,954 E753G probably damaging Het
Alas1 G A 9: 106,238,660 T385I probably damaging Het
Alms1 C A 6: 85,667,963 probably benign Het
Ankrd65 A G 4: 155,791,411 T30A possibly damaging Het
App T C 16: 84,978,229 S582G probably damaging Het
Arfgef1 A T 1: 10,153,654 V1473E possibly damaging Het
Arhgap21 G A 2: 20,854,998 P1196S probably damaging Het
Arhgap24 A G 5: 102,891,910 T238A probably benign Het
Atf7 T C 15: 102,529,004 probably benign Het
Best1 G T 19: 9,993,311 S55* probably null Het
Capn11 A G 17: 45,633,799 V514A probably damaging Het
Cep104 T A 4: 153,989,146 M52K probably damaging Het
Clca3a1 C T 3: 144,737,858 probably null Het
Cyp3a25 T C 5: 146,003,027 probably null Het
Dmxl2 G A 9: 54,400,094 P2197S probably damaging Het
Drosha T C 15: 12,859,465 probably null Het
Exosc9 A G 3: 36,563,162 K355R probably benign Het
Fut1 A C 7: 45,619,198 H192P probably benign Het
Gm572 T A 4: 148,664,384 V166D possibly damaging Het
Gm9966 C T 7: 95,958,528 P19S unknown Het
Gmds C T 13: 32,100,473 V219I probably damaging Het
Gsn G A 2: 35,283,953 E25K probably benign Het
Il4i1 T C 7: 44,839,891 F368S probably damaging Het
Irak1bp1 T C 9: 82,830,320 L98P probably damaging Het
Khdrbs3 T C 15: 69,024,695 probably benign Het
Kndc1 T C 7: 139,921,822 I925T probably damaging Het
Laptm4a T C 12: 8,938,151 I296T probably benign Het
Lpl A T 8: 68,887,518 H55L probably benign Het
Lrrk2 C A 15: 91,755,927 N1558K probably benign Het
Mfsd2a A G 4: 122,950,487 L289P probably damaging Het
Mmrn2 T A 14: 34,398,802 M543K probably benign Het
Mnat1 T C 12: 73,181,776 probably benign Het
Msto1 A T 3: 88,911,893 probably null Het
Mtus1 A G 8: 41,082,739 Y647H probably damaging Het
Nars A T 18: 64,505,016 V289E probably damaging Het
Oit3 T A 10: 59,428,345 K322N probably damaging Het
Oit3 G A 10: 59,441,685 probably benign Het
Olfr1024 A G 2: 85,904,556 I166T probably benign Het
Olfr1467 T A 19: 13,365,193 C188* probably null Het
Olfr728 T C 14: 50,139,983 I219V probably benign Het
Olfr801 G A 10: 129,670,286 R78W probably damaging Het
Pecr A T 1: 72,277,310 C79S probably damaging Het
Plekhn1 T C 4: 156,222,659 D478G probably damaging Het
Pls1 A T 9: 95,776,563 M264K probably benign Het
Ptprj C A 2: 90,474,996 probably benign Het
Pygm A G 19: 6,397,601 D646G probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scn8a T C 15: 100,969,162 V283A probably benign Het
Slc10a4 A G 5: 73,008,505 I246V possibly damaging Het
Slc1a1 A T 19: 28,892,912 I104F probably benign Het
Slc22a8 A G 19: 8,610,195 Y511C probably benign Het
Slc6a5 A G 7: 49,956,462 N706S probably benign Het
Sos2 T C 12: 69,650,659 K96E probably damaging Het
Stom G A 2: 35,315,965 R251* probably null Het
Sycp1 T C 3: 102,845,066 E800G probably benign Het
Tab2 G A 10: 7,907,481 P679L probably damaging Het
Tiam2 G A 17: 3,453,382 V945I probably damaging Het
Trpm5 G T 7: 143,074,517 P1007Q probably damaging Het
Uchl1 T G 5: 66,682,613 I139S probably damaging Het
Vmn1r232 A G 17: 20,914,026 I104T possibly damaging Het
Vmn2r97 G A 17: 18,947,552 M689I probably benign Het
Zc3h18 A T 8: 122,403,165 probably benign Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp456 T C 13: 67,362,372 K99R probably benign Het
Other mutations in Shisa5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02735:Shisa5 APN 9 109056012 missense probably damaging 1.00
IGL02989:Shisa5 APN 9 109055994 missense probably damaging 1.00
IGL03169:Shisa5 APN 9 109056492 missense probably damaging 1.00
R1809:Shisa5 UTSW 9 109040930 missense probably damaging 0.99
R1813:Shisa5 UTSW 9 109056040 missense probably damaging 0.99
R1896:Shisa5 UTSW 9 109056040 missense probably damaging 0.99
R4706:Shisa5 UTSW 9 109056060 missense probably null 0.99
R5800:Shisa5 UTSW 9 109056094 critical splice donor site probably null
R5935:Shisa5 UTSW 9 109056683 missense possibly damaging 0.68
R7299:Shisa5 UTSW 9 109054884 intron probably benign
R7301:Shisa5 UTSW 9 109054884 intron probably benign
Predicted Primers PCR Primer
(F):5'- TTGCAGCTGTCGTGACCAAC -3'
(R):5'- AATCCATGTAGGTCGGGTTG -3'

Sequencing Primer
(F):5'- ACAACTACTACCGTGGTTCATG -3'
(R):5'- AATCCATGTAGGTCGGGTTGTATGG -3'
Posted On2014-12-04