Incidental Mutation 'R2516:Tab2'
ID253819
Institutional Source Beutler Lab
Gene Symbol Tab2
Ensembl Gene ENSMUSG00000015755
Gene NameTGF-beta activated kinase 1/MAP3K7 binding protein 2
Synonyms1110030N06Rik, Map3k7ip2, A530078N03Rik, Tak1 binding protein 2
MMRRC Submission 040420-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2516 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location7905653-7956230 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 7907481 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 679 (P679L)
Ref Sequence ENSEMBL: ENSMUSP00000121266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000146444] [ENSMUST00000147938]
PDB Structure
Crystal structure of the mouse TAB2-NZF in complex with Lys63-linked di-ubiquitin [X-RAY DIFFRACTION]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142007
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143848
Predicted Effect probably damaging
Transcript: ENSMUST00000146444
AA Change: P679L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121266
Gene: ENSMUSG00000015755
AA Change: P679L

DomainStartEndE-ValueType
CUE 8 50 1.15e-10 SMART
low complexity region 286 311 N/A INTRINSIC
coiled coil region 532 619 N/A INTRINSIC
ZnF_RBZ 666 690 1.91e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147938
SMART Domains Protein: ENSMUSP00000119515
Gene: ENSMUSG00000015755

DomainStartEndE-ValueType
CUE 8 50 1.15e-10 SMART
low complexity region 286 311 N/A INTRINSIC
Meta Mutation Damage Score 0.8467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an activator of MAP3K7/TAK1, which is required for for the IL-1 induced activation of nuclear factor kappaB and MAPK8/JNK. This protein forms a kinase complex with TRAF6, MAP3K7 and TAB1, and it thus serves as an adaptor that links MAP3K7 and TRAF6. This protein, along with TAB1 and MAP3K7, also participates in the signal transduction induced by TNFSF11/RANKl through the activation of the receptor activator of NF-kappaB (TNFRSF11A/RANK), which may regulate the development and function of osteoclasts. Studies of the related mouse protein indicate that it functions to protect against liver damage caused by chemical stressors. Mutations in this gene cause congenital heart defects, multiple types, 2 (CHTD2). Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Embryos homozygous for a knock-out allele are viable up to E9.5. Embryos homozygous for a different knock-out allele are normal and viable up to E11.5 but become pale and anemic, exhibit liver hemorrhage and increased apoptosis of hepatoblasts, and die by E12.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,329,329 I6N possibly damaging Het
Aen T C 7: 78,905,868 V188A probably damaging Het
Afg3l1 A G 8: 123,501,954 E753G probably damaging Het
Alas1 G A 9: 106,238,660 T385I probably damaging Het
Alms1 C A 6: 85,667,963 probably benign Het
Ankrd65 A G 4: 155,791,411 T30A possibly damaging Het
App T C 16: 84,978,229 S582G probably damaging Het
Arfgef1 A T 1: 10,153,654 V1473E possibly damaging Het
Arhgap21 G A 2: 20,854,998 P1196S probably damaging Het
Arhgap24 A G 5: 102,891,910 T238A probably benign Het
Atf7 T C 15: 102,529,004 probably benign Het
Best1 G T 19: 9,993,311 S55* probably null Het
Capn11 A G 17: 45,633,799 V514A probably damaging Het
Cep104 T A 4: 153,989,146 M52K probably damaging Het
Clca3a1 C T 3: 144,737,858 probably null Het
Cyp3a25 T C 5: 146,003,027 probably null Het
Dmxl2 G A 9: 54,400,094 P2197S probably damaging Het
Drosha T C 15: 12,859,465 probably null Het
Exosc9 A G 3: 36,563,162 K355R probably benign Het
Fut1 A C 7: 45,619,198 H192P probably benign Het
Gm572 T A 4: 148,664,384 V166D possibly damaging Het
Gm9966 C T 7: 95,958,528 P19S unknown Het
Gmds C T 13: 32,100,473 V219I probably damaging Het
Gsn G A 2: 35,283,953 E25K probably benign Het
Il4i1 T C 7: 44,839,891 F368S probably damaging Het
Irak1bp1 T C 9: 82,830,320 L98P probably damaging Het
Khdrbs3 T C 15: 69,024,695 probably benign Het
Kndc1 T C 7: 139,921,822 I925T probably damaging Het
Laptm4a T C 12: 8,938,151 I296T probably benign Het
Lpl A T 8: 68,887,518 H55L probably benign Het
Lrrk2 C A 15: 91,755,927 N1558K probably benign Het
Mfsd2a A G 4: 122,950,487 L289P probably damaging Het
Mmrn2 T A 14: 34,398,802 M543K probably benign Het
Mnat1 T C 12: 73,181,776 probably benign Het
Msto1 A T 3: 88,911,893 probably null Het
Mtus1 A G 8: 41,082,739 Y647H probably damaging Het
Nars A T 18: 64,505,016 V289E probably damaging Het
Oit3 T A 10: 59,428,345 K322N probably damaging Het
Oit3 G A 10: 59,441,685 probably benign Het
Olfr1024 A G 2: 85,904,556 I166T probably benign Het
Olfr1467 T A 19: 13,365,193 C188* probably null Het
Olfr728 T C 14: 50,139,983 I219V probably benign Het
Olfr801 G A 10: 129,670,286 R78W probably damaging Het
Pecr A T 1: 72,277,310 C79S probably damaging Het
Plekhn1 T C 4: 156,222,659 D478G probably damaging Het
Pls1 A T 9: 95,776,563 M264K probably benign Het
Ptprj C A 2: 90,474,996 probably benign Het
Pygm A G 19: 6,397,601 D646G probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scn8a T C 15: 100,969,162 V283A probably benign Het
Shisa5 T C 9: 109,056,507 probably null Het
Slc10a4 A G 5: 73,008,505 I246V possibly damaging Het
Slc1a1 A T 19: 28,892,912 I104F probably benign Het
Slc22a8 A G 19: 8,610,195 Y511C probably benign Het
Slc6a5 A G 7: 49,956,462 N706S probably benign Het
Sos2 T C 12: 69,650,659 K96E probably damaging Het
Stom G A 2: 35,315,965 R251* probably null Het
Sycp1 T C 3: 102,845,066 E800G probably benign Het
Tiam2 G A 17: 3,453,382 V945I probably damaging Het
Trpm5 G T 7: 143,074,517 P1007Q probably damaging Het
Uchl1 T G 5: 66,682,613 I139S probably damaging Het
Vmn1r232 A G 17: 20,914,026 I104T possibly damaging Het
Vmn2r97 G A 17: 18,947,552 M689I probably benign Het
Zc3h18 A T 8: 122,403,165 probably benign Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp456 T C 13: 67,362,372 K99R probably benign Het
Other mutations in Tab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Tab2 APN 10 7910073 missense probably benign 0.21
IGL01316:Tab2 APN 10 7924704 missense probably damaging 1.00
IGL01902:Tab2 APN 10 7919992 missense probably benign 0.12
IGL03338:Tab2 APN 10 7919275 missense probably damaging 1.00
Cosmo UTSW 10 7924719 missense probably damaging 1.00
Cosmo-2 UTSW 10 7907481 missense probably damaging 1.00
R0068:Tab2 UTSW 10 7919677 missense probably damaging 1.00
R0068:Tab2 UTSW 10 7919677 missense probably damaging 1.00
R0271:Tab2 UTSW 10 7919158 missense probably benign
R0458:Tab2 UTSW 10 7919555 missense probably damaging 1.00
R0608:Tab2 UTSW 10 7920119 missense probably damaging 0.99
R0632:Tab2 UTSW 10 7919801 missense probably benign 0.07
R0744:Tab2 UTSW 10 7907581 unclassified probably benign
R1162:Tab2 UTSW 10 7924719 missense probably damaging 1.00
R1424:Tab2 UTSW 10 7920048 missense possibly damaging 0.86
R1954:Tab2 UTSW 10 7919330 missense probably damaging 1.00
R2518:Tab2 UTSW 10 7907481 missense probably damaging 1.00
R2520:Tab2 UTSW 10 7907481 missense probably damaging 1.00
R3418:Tab2 UTSW 10 7907481 missense probably damaging 1.00
R4081:Tab2 UTSW 10 7919831 missense probably damaging 1.00
R4177:Tab2 UTSW 10 7919359 missense probably damaging 1.00
R4178:Tab2 UTSW 10 7919359 missense probably damaging 1.00
R5410:Tab2 UTSW 10 7919821 missense possibly damaging 0.86
R5681:Tab2 UTSW 10 7920073 missense probably damaging 1.00
R5683:Tab2 UTSW 10 7919112 critical splice donor site probably null
R6857:Tab2 UTSW 10 7920413 missense possibly damaging 0.50
R7424:Tab2 UTSW 10 7907483 missense probably damaging 1.00
R7692:Tab2 UTSW 10 7911105 missense probably damaging 1.00
R7790:Tab2 UTSW 10 7920424 missense probably damaging 1.00
R7792:Tab2 UTSW 10 7919133 missense possibly damaging 0.50
Z1088:Tab2 UTSW 10 7920266 missense possibly damaging 0.88
Z1177:Tab2 UTSW 10 7919179 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TTAGCTCTGTGGGCTGACAC -3'
(R):5'- AGGGGAAGCATGGTCAGTTC -3'

Sequencing Primer
(F):5'- TCTGTGGGCTGACACTCAACAC -3'
(R):5'- TACAGATCAAAGGTCCACCA -3'
Posted On2014-12-04