Incidental Mutation 'R2516:Oit3'
ID 253821
Institutional Source Beutler Lab
Gene Symbol Oit3
Ensembl Gene ENSMUSG00000009654
Gene Name oncoprotein induced transcript 3
Synonyms EF-9
MMRRC Submission 040420-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.314) question?
Stock # R2516 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 59258782-59277601 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 59264167 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 322 (K322N)
Ref Sequence ENSEMBL: ENSMUSP00000009798 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009798]
AlphaFold Q8R4V5
Predicted Effect probably damaging
Transcript: ENSMUST00000009798
AA Change: K322N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000009798
Gene: ENSMUSG00000009654
AA Change: K322N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:ZP 50 144 9e-24 BLAST
EGF 150 181 2.16e1 SMART
EGF 185 222 2.94e-3 SMART
EGF 226 263 2.35e-2 SMART
ZP 267 516 2.74e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162493
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified due to its downregulation in hepatocarcinomas. The encoded protein may be involved in liver development and function. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased bloord uric acid, increased urine uric acid and polyuria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,159,673 (GRCm39) I6N possibly damaging Het
Aen T C 7: 78,555,616 (GRCm39) V188A probably damaging Het
Afg3l1 A G 8: 124,228,693 (GRCm39) E753G probably damaging Het
Alas1 G A 9: 106,115,859 (GRCm39) T385I probably damaging Het
Alms1 C A 6: 85,644,945 (GRCm39) probably benign Het
Ankrd65 A G 4: 155,875,868 (GRCm39) T30A possibly damaging Het
App T C 16: 84,775,117 (GRCm39) S582G probably damaging Het
Arfgef1 A T 1: 10,223,879 (GRCm39) V1473E possibly damaging Het
Arhgap21 G A 2: 20,859,809 (GRCm39) P1196S probably damaging Het
Arhgap24 A G 5: 103,039,776 (GRCm39) T238A probably benign Het
Atf7 T C 15: 102,437,439 (GRCm39) probably benign Het
Best1 G T 19: 9,970,675 (GRCm39) S55* probably null Het
Capn11 A G 17: 45,944,725 (GRCm39) V514A probably damaging Het
Cep104 T A 4: 154,073,603 (GRCm39) M52K probably damaging Het
Clca3a1 C T 3: 144,443,619 (GRCm39) probably null Het
Cyp3a25 T C 5: 145,939,837 (GRCm39) probably null Het
Dmxl2 G A 9: 54,307,378 (GRCm39) P2197S probably damaging Het
Drosha T C 15: 12,859,551 (GRCm39) probably null Het
Exosc9 A G 3: 36,617,311 (GRCm39) K355R probably benign Het
Fut1 A C 7: 45,268,622 (GRCm39) H192P probably benign Het
Gm572 T A 4: 148,748,841 (GRCm39) V166D possibly damaging Het
Gm9966 C T 7: 95,607,735 (GRCm39) P19S unknown Het
Gmds C T 13: 32,284,456 (GRCm39) V219I probably damaging Het
Gsn G A 2: 35,173,965 (GRCm39) E25K probably benign Het
Il4i1 T C 7: 44,489,315 (GRCm39) F368S probably damaging Het
Irak1bp1 T C 9: 82,712,373 (GRCm39) L98P probably damaging Het
Khdrbs3 T C 15: 68,896,544 (GRCm39) probably benign Het
Kndc1 T C 7: 139,501,738 (GRCm39) I925T probably damaging Het
Laptm4a T C 12: 8,988,151 (GRCm39) I296T probably benign Het
Lpl A T 8: 69,340,170 (GRCm39) H55L probably benign Het
Lrrk2 C A 15: 91,640,130 (GRCm39) N1558K probably benign Het
Mfsd2a A G 4: 122,844,280 (GRCm39) L289P probably damaging Het
Mmrn2 T A 14: 34,120,759 (GRCm39) M543K probably benign Het
Mnat1 T C 12: 73,228,550 (GRCm39) probably benign Het
Msto1 A T 3: 88,819,200 (GRCm39) probably null Het
Mtus1 A G 8: 41,535,776 (GRCm39) Y647H probably damaging Het
Nars1 A T 18: 64,638,087 (GRCm39) V289E probably damaging Het
Or4k1 T C 14: 50,377,440 (GRCm39) I219V probably benign Het
Or5b113 T A 19: 13,342,557 (GRCm39) C188* probably null Het
Or5m12 A G 2: 85,734,900 (GRCm39) I166T probably benign Het
Or6c211 G A 10: 129,506,155 (GRCm39) R78W probably damaging Het
Pecr A T 1: 72,316,469 (GRCm39) C79S probably damaging Het
Plekhn1 T C 4: 156,307,116 (GRCm39) D478G probably damaging Het
Pls1 A T 9: 95,658,616 (GRCm39) M264K probably benign Het
Ptprj C A 2: 90,305,340 (GRCm39) probably benign Het
Pygm A G 19: 6,447,631 (GRCm39) D646G probably benign Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Scn8a T C 15: 100,867,043 (GRCm39) V283A probably benign Het
Shisa5 T C 9: 108,885,575 (GRCm39) probably null Het
Slc10a4 A G 5: 73,165,848 (GRCm39) I246V possibly damaging Het
Slc1a1 A T 19: 28,870,312 (GRCm39) I104F probably benign Het
Slc22a8 A G 19: 8,587,559 (GRCm39) Y511C probably benign Het
Slc6a5 A G 7: 49,606,210 (GRCm39) N706S probably benign Het
Sos2 T C 12: 69,697,433 (GRCm39) K96E probably damaging Het
Stom G A 2: 35,205,977 (GRCm39) R251* probably null Het
Sycp1 T C 3: 102,752,382 (GRCm39) E800G probably benign Het
Tab2 G A 10: 7,783,245 (GRCm39) P679L probably damaging Het
Tiam2 G A 17: 3,503,657 (GRCm39) V945I probably damaging Het
Trpm5 G T 7: 142,628,254 (GRCm39) P1007Q probably damaging Het
Uchl1 T G 5: 66,839,956 (GRCm39) I139S probably damaging Het
Vmn1r232 A G 17: 21,134,288 (GRCm39) I104T possibly damaging Het
Vmn2r97 G A 17: 19,167,814 (GRCm39) M689I probably benign Het
Zc3h18 A T 8: 123,129,904 (GRCm39) probably benign Het
Zfhx4 C T 3: 5,468,418 (GRCm39) P2859S probably benign Het
Zfp456 T C 13: 67,510,491 (GRCm39) K99R probably benign Het
Other mutations in Oit3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01457:Oit3 APN 10 59,261,306 (GRCm39) unclassified probably benign
IGL01665:Oit3 APN 10 59,274,731 (GRCm39) missense probably damaging 1.00
IGL01839:Oit3 APN 10 59,265,318 (GRCm39) missense probably damaging 0.98
IGL02028:Oit3 APN 10 59,274,477 (GRCm39) missense probably damaging 0.98
PIT4585001:Oit3 UTSW 10 59,266,835 (GRCm39) missense possibly damaging 0.54
R0567:Oit3 UTSW 10 59,271,800 (GRCm39) missense probably damaging 0.99
R0781:Oit3 UTSW 10 59,264,016 (GRCm39) missense probably damaging 1.00
R1110:Oit3 UTSW 10 59,264,016 (GRCm39) missense probably damaging 1.00
R1563:Oit3 UTSW 10 59,263,896 (GRCm39) missense probably damaging 1.00
R1623:Oit3 UTSW 10 59,264,061 (GRCm39) missense probably damaging 0.99
R1693:Oit3 UTSW 10 59,261,239 (GRCm39) missense probably damaging 1.00
R1754:Oit3 UTSW 10 59,263,762 (GRCm39) splice site probably null
R1853:Oit3 UTSW 10 59,277,444 (GRCm39) critical splice donor site probably null
R2070:Oit3 UTSW 10 59,266,835 (GRCm39) missense probably benign 0.03
R2211:Oit3 UTSW 10 59,263,892 (GRCm39) missense probably damaging 1.00
R2516:Oit3 UTSW 10 59,277,507 (GRCm39) start gained probably benign
R3103:Oit3 UTSW 10 59,274,713 (GRCm39) missense probably damaging 0.98
R4414:Oit3 UTSW 10 59,263,925 (GRCm39) missense probably damaging 1.00
R4415:Oit3 UTSW 10 59,263,925 (GRCm39) missense probably damaging 1.00
R4416:Oit3 UTSW 10 59,263,925 (GRCm39) missense probably damaging 1.00
R4417:Oit3 UTSW 10 59,263,925 (GRCm39) missense probably damaging 1.00
R4584:Oit3 UTSW 10 59,261,284 (GRCm39) missense probably damaging 1.00
R4734:Oit3 UTSW 10 59,259,904 (GRCm39) missense probably damaging 0.99
R4748:Oit3 UTSW 10 59,259,904 (GRCm39) missense probably damaging 0.99
R4749:Oit3 UTSW 10 59,259,904 (GRCm39) missense probably damaging 0.99
R5070:Oit3 UTSW 10 59,259,849 (GRCm39) missense probably damaging 1.00
R5521:Oit3 UTSW 10 59,271,736 (GRCm39) missense probably benign
R6326:Oit3 UTSW 10 59,264,061 (GRCm39) missense probably damaging 1.00
R6490:Oit3 UTSW 10 59,274,374 (GRCm39) missense possibly damaging 0.92
R6526:Oit3 UTSW 10 59,265,462 (GRCm39) missense probably damaging 1.00
R6766:Oit3 UTSW 10 59,274,534 (GRCm39) missense probably damaging 0.99
R6921:Oit3 UTSW 10 59,271,767 (GRCm39) missense probably damaging 0.99
R7129:Oit3 UTSW 10 59,264,166 (GRCm39) missense probably damaging 0.99
R7440:Oit3 UTSW 10 59,265,392 (GRCm39) missense probably damaging 0.99
R7495:Oit3 UTSW 10 59,259,765 (GRCm39) missense possibly damaging 0.74
R7512:Oit3 UTSW 10 59,274,716 (GRCm39) missense probably damaging 1.00
R7866:Oit3 UTSW 10 59,259,852 (GRCm39) missense probably benign 0.03
R8312:Oit3 UTSW 10 59,274,632 (GRCm39) missense probably benign 0.01
R8321:Oit3 UTSW 10 59,263,982 (GRCm39) missense probably benign 0.00
R8919:Oit3 UTSW 10 59,277,468 (GRCm39) missense unknown
R9131:Oit3 UTSW 10 59,271,751 (GRCm39) missense probably benign 0.01
R9457:Oit3 UTSW 10 59,277,505 (GRCm39) start codon destroyed unknown
R9478:Oit3 UTSW 10 59,274,464 (GRCm39) missense probably damaging 0.99
R9502:Oit3 UTSW 10 59,264,173 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCCAATGGGGCATTGCG -3'
(R):5'- TGGTACCACTTCCTGTTGGC -3'

Sequencing Primer
(F):5'- GCAGGTTGGGCACGTATC -3'
(R):5'- ATAGCTGAAACGCCTCTGTACTGG -3'
Posted On 2014-12-04