Incidental Mutation 'R2516:Oit3'
ID253821
Institutional Source Beutler Lab
Gene Symbol Oit3
Ensembl Gene ENSMUSG00000009654
Gene Nameoncoprotein induced transcript 3
SynonymsEF-9
MMRRC Submission 040420-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.441) question?
Stock #R2516 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location59422958-59441778 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59428345 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 322 (K322N)
Ref Sequence ENSEMBL: ENSMUSP00000009798 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009798]
Predicted Effect probably damaging
Transcript: ENSMUST00000009798
AA Change: K322N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000009798
Gene: ENSMUSG00000009654
AA Change: K322N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:ZP 50 144 9e-24 BLAST
EGF 150 181 2.16e1 SMART
EGF 185 222 2.94e-3 SMART
EGF 226 263 2.35e-2 SMART
ZP 267 516 2.74e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162493
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified due to its downregulation in hepatocarcinomas. The encoded protein may be involved in liver development and function. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased bloord uric acid, increased urine uric acid and polyuria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,329,329 I6N possibly damaging Het
Aen T C 7: 78,905,868 V188A probably damaging Het
Afg3l1 A G 8: 123,501,954 E753G probably damaging Het
Alas1 G A 9: 106,238,660 T385I probably damaging Het
Alms1 C A 6: 85,667,963 probably benign Het
Ankrd65 A G 4: 155,791,411 T30A possibly damaging Het
App T C 16: 84,978,229 S582G probably damaging Het
Arfgef1 A T 1: 10,153,654 V1473E possibly damaging Het
Arhgap21 G A 2: 20,854,998 P1196S probably damaging Het
Arhgap24 A G 5: 102,891,910 T238A probably benign Het
Atf7 T C 15: 102,529,004 probably benign Het
Best1 G T 19: 9,993,311 S55* probably null Het
Capn11 A G 17: 45,633,799 V514A probably damaging Het
Cep104 T A 4: 153,989,146 M52K probably damaging Het
Clca3a1 C T 3: 144,737,858 probably null Het
Cyp3a25 T C 5: 146,003,027 probably null Het
Dmxl2 G A 9: 54,400,094 P2197S probably damaging Het
Drosha T C 15: 12,859,465 probably null Het
Exosc9 A G 3: 36,563,162 K355R probably benign Het
Fut1 A C 7: 45,619,198 H192P probably benign Het
Gm572 T A 4: 148,664,384 V166D possibly damaging Het
Gm9966 C T 7: 95,958,528 P19S unknown Het
Gmds C T 13: 32,100,473 V219I probably damaging Het
Gsn G A 2: 35,283,953 E25K probably benign Het
Il4i1 T C 7: 44,839,891 F368S probably damaging Het
Irak1bp1 T C 9: 82,830,320 L98P probably damaging Het
Khdrbs3 T C 15: 69,024,695 probably benign Het
Kndc1 T C 7: 139,921,822 I925T probably damaging Het
Laptm4a T C 12: 8,938,151 I296T probably benign Het
Lpl A T 8: 68,887,518 H55L probably benign Het
Lrrk2 C A 15: 91,755,927 N1558K probably benign Het
Mfsd2a A G 4: 122,950,487 L289P probably damaging Het
Mmrn2 T A 14: 34,398,802 M543K probably benign Het
Mnat1 T C 12: 73,181,776 probably benign Het
Msto1 A T 3: 88,911,893 probably null Het
Mtus1 A G 8: 41,082,739 Y647H probably damaging Het
Nars A T 18: 64,505,016 V289E probably damaging Het
Olfr1024 A G 2: 85,904,556 I166T probably benign Het
Olfr1467 T A 19: 13,365,193 C188* probably null Het
Olfr728 T C 14: 50,139,983 I219V probably benign Het
Olfr801 G A 10: 129,670,286 R78W probably damaging Het
Pecr A T 1: 72,277,310 C79S probably damaging Het
Plekhn1 T C 4: 156,222,659 D478G probably damaging Het
Pls1 A T 9: 95,776,563 M264K probably benign Het
Ptprj C A 2: 90,474,996 probably benign Het
Pygm A G 19: 6,397,601 D646G probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scn8a T C 15: 100,969,162 V283A probably benign Het
Shisa5 T C 9: 109,056,507 probably null Het
Slc10a4 A G 5: 73,008,505 I246V possibly damaging Het
Slc1a1 A T 19: 28,892,912 I104F probably benign Het
Slc22a8 A G 19: 8,610,195 Y511C probably benign Het
Slc6a5 A G 7: 49,956,462 N706S probably benign Het
Sos2 T C 12: 69,650,659 K96E probably damaging Het
Stom G A 2: 35,315,965 R251* probably null Het
Sycp1 T C 3: 102,845,066 E800G probably benign Het
Tab2 G A 10: 7,907,481 P679L probably damaging Het
Tiam2 G A 17: 3,453,382 V945I probably damaging Het
Trpm5 G T 7: 143,074,517 P1007Q probably damaging Het
Uchl1 T G 5: 66,682,613 I139S probably damaging Het
Vmn1r232 A G 17: 20,914,026 I104T possibly damaging Het
Vmn2r97 G A 17: 18,947,552 M689I probably benign Het
Zc3h18 A T 8: 122,403,165 probably benign Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp456 T C 13: 67,362,372 K99R probably benign Het
Other mutations in Oit3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01457:Oit3 APN 10 59425484 unclassified probably benign
IGL01665:Oit3 APN 10 59438909 missense probably damaging 1.00
IGL01839:Oit3 APN 10 59429496 missense probably damaging 0.98
IGL02028:Oit3 APN 10 59438655 missense probably damaging 0.98
PIT4585001:Oit3 UTSW 10 59431013 missense possibly damaging 0.54
R0567:Oit3 UTSW 10 59435978 missense probably damaging 0.99
R0781:Oit3 UTSW 10 59428194 missense probably damaging 1.00
R1110:Oit3 UTSW 10 59428194 missense probably damaging 1.00
R1563:Oit3 UTSW 10 59428074 missense probably damaging 1.00
R1623:Oit3 UTSW 10 59428239 missense probably damaging 0.99
R1693:Oit3 UTSW 10 59425417 missense probably damaging 1.00
R1754:Oit3 UTSW 10 59427940 splice site probably null
R1853:Oit3 UTSW 10 59441622 critical splice donor site probably null
R2070:Oit3 UTSW 10 59431013 missense probably benign 0.03
R2211:Oit3 UTSW 10 59428070 missense probably damaging 1.00
R2516:Oit3 UTSW 10 59441685 start gained probably benign
R3103:Oit3 UTSW 10 59438891 missense probably damaging 0.98
R4414:Oit3 UTSW 10 59428103 missense probably damaging 1.00
R4415:Oit3 UTSW 10 59428103 missense probably damaging 1.00
R4416:Oit3 UTSW 10 59428103 missense probably damaging 1.00
R4417:Oit3 UTSW 10 59428103 missense probably damaging 1.00
R4584:Oit3 UTSW 10 59425462 missense probably damaging 1.00
R4734:Oit3 UTSW 10 59424082 missense probably damaging 0.99
R4748:Oit3 UTSW 10 59424082 missense probably damaging 0.99
R4749:Oit3 UTSW 10 59424082 missense probably damaging 0.99
R5070:Oit3 UTSW 10 59424027 missense probably damaging 1.00
R5521:Oit3 UTSW 10 59435914 missense probably benign
R6326:Oit3 UTSW 10 59428239 missense probably damaging 1.00
R6490:Oit3 UTSW 10 59438552 missense possibly damaging 0.92
R6526:Oit3 UTSW 10 59429640 missense probably damaging 1.00
R6766:Oit3 UTSW 10 59438712 missense probably damaging 0.99
R6921:Oit3 UTSW 10 59435945 missense probably damaging 0.99
R7129:Oit3 UTSW 10 59428344 missense probably damaging 0.99
R7440:Oit3 UTSW 10 59429570 missense probably damaging 0.99
R7495:Oit3 UTSW 10 59423943 missense possibly damaging 0.74
R7512:Oit3 UTSW 10 59438894 missense probably damaging 1.00
R7866:Oit3 UTSW 10 59424030 missense probably benign 0.03
R8312:Oit3 UTSW 10 59438810 missense probably benign 0.01
R8321:Oit3 UTSW 10 59428160 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTCCAATGGGGCATTGCG -3'
(R):5'- TGGTACCACTTCCTGTTGGC -3'

Sequencing Primer
(F):5'- GCAGGTTGGGCACGTATC -3'
(R):5'- ATAGCTGAAACGCCTCTGTACTGG -3'
Posted On2014-12-04