Incidental Mutation 'R2516:Olfr728'
ID253843
Institutional Source Beutler Lab
Gene Symbol Olfr728
Ensembl Gene ENSMUSG00000050030
Gene Nameolfactory receptor 728
SynonymsMOR246-1P, GA_x6K02T2PMLR-5831021-5830086
MMRRC Submission 040420-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.250) question?
Stock #R2516 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location50133758-50142680 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50139983 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 219 (I219V)
Ref Sequence ENSEMBL: ENSMUSP00000149796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051563] [ENSMUST00000213163] [ENSMUST00000213685] [ENSMUST00000215327] [ENSMUST00000215451]
Predicted Effect probably benign
Transcript: ENSMUST00000051563
AA Change: I219V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000052079
Gene: ENSMUSG00000050030
AA Change: I219V

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 9.8e-43 PFAM
Pfam:7TM_GPCR_Srx 31 304 9.8e-7 PFAM
Pfam:7TM_GPCR_Srsx 35 297 6.5e-9 PFAM
Pfam:7tm_1 41 287 1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213163
Predicted Effect probably benign
Transcript: ENSMUST00000213685
AA Change: I219V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214046
Predicted Effect probably benign
Transcript: ENSMUST00000215327
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215329
Predicted Effect probably benign
Transcript: ENSMUST00000215451
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216423
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,329,329 I6N possibly damaging Het
Aen T C 7: 78,905,868 V188A probably damaging Het
Afg3l1 A G 8: 123,501,954 E753G probably damaging Het
Alas1 G A 9: 106,238,660 T385I probably damaging Het
Alms1 C A 6: 85,667,963 probably benign Het
Ankrd65 A G 4: 155,791,411 T30A possibly damaging Het
App T C 16: 84,978,229 S582G probably damaging Het
Arfgef1 A T 1: 10,153,654 V1473E possibly damaging Het
Arhgap21 G A 2: 20,854,998 P1196S probably damaging Het
Arhgap24 A G 5: 102,891,910 T238A probably benign Het
Atf7 T C 15: 102,529,004 probably benign Het
Best1 G T 19: 9,993,311 S55* probably null Het
Capn11 A G 17: 45,633,799 V514A probably damaging Het
Cep104 T A 4: 153,989,146 M52K probably damaging Het
Clca3a1 C T 3: 144,737,858 probably null Het
Cyp3a25 T C 5: 146,003,027 probably null Het
Dmxl2 G A 9: 54,400,094 P2197S probably damaging Het
Drosha T C 15: 12,859,465 probably null Het
Exosc9 A G 3: 36,563,162 K355R probably benign Het
Fut1 A C 7: 45,619,198 H192P probably benign Het
Gm572 T A 4: 148,664,384 V166D possibly damaging Het
Gm9966 C T 7: 95,958,528 P19S unknown Het
Gmds C T 13: 32,100,473 V219I probably damaging Het
Gsn G A 2: 35,283,953 E25K probably benign Het
Il4i1 T C 7: 44,839,891 F368S probably damaging Het
Irak1bp1 T C 9: 82,830,320 L98P probably damaging Het
Khdrbs3 T C 15: 69,024,695 probably benign Het
Kndc1 T C 7: 139,921,822 I925T probably damaging Het
Laptm4a T C 12: 8,938,151 I296T probably benign Het
Lpl A T 8: 68,887,518 H55L probably benign Het
Lrrk2 C A 15: 91,755,927 N1558K probably benign Het
Mfsd2a A G 4: 122,950,487 L289P probably damaging Het
Mmrn2 T A 14: 34,398,802 M543K probably benign Het
Mnat1 T C 12: 73,181,776 probably benign Het
Msto1 A T 3: 88,911,893 probably null Het
Mtus1 A G 8: 41,082,739 Y647H probably damaging Het
Nars A T 18: 64,505,016 V289E probably damaging Het
Oit3 T A 10: 59,428,345 K322N probably damaging Het
Oit3 G A 10: 59,441,685 probably benign Het
Olfr1024 A G 2: 85,904,556 I166T probably benign Het
Olfr1467 T A 19: 13,365,193 C188* probably null Het
Olfr801 G A 10: 129,670,286 R78W probably damaging Het
Pecr A T 1: 72,277,310 C79S probably damaging Het
Plekhn1 T C 4: 156,222,659 D478G probably damaging Het
Pls1 A T 9: 95,776,563 M264K probably benign Het
Ptprj C A 2: 90,474,996 probably benign Het
Pygm A G 19: 6,397,601 D646G probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scn8a T C 15: 100,969,162 V283A probably benign Het
Shisa5 T C 9: 109,056,507 probably null Het
Slc10a4 A G 5: 73,008,505 I246V possibly damaging Het
Slc1a1 A T 19: 28,892,912 I104F probably benign Het
Slc22a8 A G 19: 8,610,195 Y511C probably benign Het
Slc6a5 A G 7: 49,956,462 N706S probably benign Het
Sos2 T C 12: 69,650,659 K96E probably damaging Het
Stom G A 2: 35,315,965 R251* probably null Het
Sycp1 T C 3: 102,845,066 E800G probably benign Het
Tab2 G A 10: 7,907,481 P679L probably damaging Het
Tiam2 G A 17: 3,453,382 V945I probably damaging Het
Trpm5 G T 7: 143,074,517 P1007Q probably damaging Het
Uchl1 T G 5: 66,682,613 I139S probably damaging Het
Vmn1r232 A G 17: 20,914,026 I104T possibly damaging Het
Vmn2r97 G A 17: 18,947,552 M689I probably benign Het
Zc3h18 A T 8: 122,403,165 probably benign Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp456 T C 13: 67,362,372 K99R probably benign Het
Other mutations in Olfr728
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01101:Olfr728 APN 14 50140054 missense probably benign 0.06
IGL02080:Olfr728 APN 14 50140122 missense probably damaging 1.00
IGL03187:Olfr728 APN 14 50139800 missense probably damaging 0.98
R1613:Olfr728 UTSW 14 50140294 missense probably damaging 1.00
R1671:Olfr728 UTSW 14 50139833 missense probably damaging 1.00
R1876:Olfr728 UTSW 14 50140172 missense probably damaging 0.99
R2085:Olfr728 UTSW 14 50140123 missense probably damaging 1.00
R2086:Olfr728 UTSW 14 50140123 missense probably damaging 1.00
R2158:Olfr728 UTSW 14 50140123 missense probably damaging 1.00
R2226:Olfr728 UTSW 14 50140619 missense probably damaging 1.00
R4454:Olfr728 UTSW 14 50140496 missense probably benign 0.00
R4714:Olfr728 UTSW 14 50139979 missense possibly damaging 0.55
R4754:Olfr728 UTSW 14 50140033 missense possibly damaging 0.90
R4754:Olfr728 UTSW 14 50140034 missense probably benign 0.02
R5275:Olfr728 UTSW 14 50140496 missense probably benign 0.35
R5339:Olfr728 UTSW 14 50140302 missense probably damaging 0.96
R6614:Olfr728 UTSW 14 50140364 missense probably damaging 1.00
R6713:Olfr728 UTSW 14 50139724 missense probably benign
R6900:Olfr728 UTSW 14 50139838 missense possibly damaging 0.94
R7062:Olfr728 UTSW 14 50140450 missense probably damaging 1.00
R7192:Olfr728 UTSW 14 50140120 missense possibly damaging 0.48
R7528:Olfr728 UTSW 14 50139820 missense possibly damaging 0.93
R7740:Olfr728 UTSW 14 50140346 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCCTCAAGGCTGATTTCACATC -3'
(R):5'- CTTCATTCTGTGAGCCATTTGG -3'

Sequencing Primer
(F):5'- AAGGCTGATTTCACATCTTCATTTC -3'
(R):5'- CGTGCATGGATACGTACA -3'
Posted On2014-12-04