Incidental Mutation 'R2516:Scn8a'
ID253851
Institutional Source Beutler Lab
Gene Symbol Scn8a
Ensembl Gene ENSMUSG00000023033
Gene Namesodium channel, voltage-gated, type VIII, alpha
Synonymsmnd2, C630029C19Rik, nmf58, NMF335, mnd-2, seal, motor end-plate disease, nur14, Nav1.6, med, ataxia 3, nmf2, nmf335, NaCh6
MMRRC Submission 040420-MU
Accession Numbers

Genbank: NM_001077499, NM_011323; MGI: 103169

Is this an essential gene? Probably essential (E-score: 0.827) question?
Stock #R2516 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location100869858-101045938 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100969162 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 283 (V283A)
Ref Sequence ENSEMBL: ENSMUSP00000144013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082209] [ENSMUST00000108908] [ENSMUST00000108909] [ENSMUST00000108910] [ENSMUST00000200963] [ENSMUST00000201518] [ENSMUST00000201549] [ENSMUST00000202702]
Predicted Effect probably benign
Transcript: ENSMUST00000082209
AA Change: V283A

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000080842
Gene: ENSMUSG00000023033
AA Change: V283A

DomainStartEndE-ValueType
Pfam:Ion_trans 131 422 7.4e-82 PFAM
low complexity region 423 452 N/A INTRINSIC
Pfam:Na_trans_cytopl 499 700 3.5e-72 PFAM
low complexity region 701 712 N/A INTRINSIC
Pfam:Ion_trans 750 985 2.2e-57 PFAM
Pfam:Na_trans_assoc 989 1191 2e-59 PFAM
Pfam:Ion_trans 1195 1472 6.2e-69 PFAM
Pfam:Ion_trans 1519 1775 1.2e-56 PFAM
IQ 1892 1914 1.2e-4 SMART
low complexity region 1953 1972 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108908
AA Change: V283A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104536
Gene: ENSMUSG00000023033
AA Change: V283A

DomainStartEndE-ValueType
Pfam:Ion_trans 72 322 1.9e-76 PFAM
low complexity region 367 378 N/A INTRINSIC
Pfam:Ion_trans 451 640 1.1e-47 PFAM
Pfam:Na_trans_assoc 655 872 1.9e-71 PFAM
Pfam:Ion_trans 898 1127 4.4e-59 PFAM
PDB:1BYY|A 1129 1181 7e-30 PDB
Pfam:Ion_trans 1220 1429 1.9e-51 PFAM
Pfam:PKD_channel 1281 1436 5.6e-7 PFAM
IQ 1558 1580 1.2e-4 SMART
low complexity region 1619 1638 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108909
AA Change: V283A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104537
Gene: ENSMUSG00000023033
AA Change: V283A

DomainStartEndE-ValueType
Pfam:Ion_trans 72 322 2.2e-76 PFAM
low complexity region 335 364 N/A INTRINSIC
Pfam:DUF3451 390 616 8.7e-70 PFAM
Pfam:Ion_trans 697 886 1.3e-47 PFAM
Pfam:Na_trans_assoc 901 1118 2.3e-71 PFAM
Pfam:Ion_trans 1144 1186 9.7e-10 PFAM
Pfam:Ion_trans 1182 1332 1.7e-31 PFAM
PDB:1BYY|A 1334 1386 2e-29 PDB
Pfam:Ion_trans 1425 1634 2.3e-51 PFAM
Pfam:PKD_channel 1486 1641 6.6e-7 PFAM
IQ 1763 1785 1.2e-4 SMART
low complexity region 1824 1843 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108910
AA Change: V283A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104538
Gene: ENSMUSG00000023033
AA Change: V283A

DomainStartEndE-ValueType
Pfam:Ion_trans 160 410 2.5e-76 PFAM
low complexity region 423 452 N/A INTRINSIC
Pfam:DUF3451 478 704 9.6e-70 PFAM
Pfam:Ion_trans 785 974 1.4e-47 PFAM
Pfam:Na_trans_assoc 989 1206 2.5e-71 PFAM
Pfam:Ion_trans 1232 1461 5.7e-59 PFAM
PDB:1BYY|A 1463 1515 4e-29 PDB
Pfam:Ion_trans 1554 1763 2.5e-51 PFAM
Pfam:PKD_channel 1615 1770 7.1e-7 PFAM
IQ 1892 1914 1.2e-4 SMART
low complexity region 1953 1972 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200963
AA Change: V283A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000144371
Gene: ENSMUSG00000023033
AA Change: V283A

DomainStartEndE-ValueType
Pfam:Ion_trans 131 422 4.1e-80 PFAM
low complexity region 423 452 N/A INTRINSIC
Pfam:Na_trans_cytopl 499 700 2.5e-69 PFAM
low complexity region 701 712 N/A INTRINSIC
Pfam:Ion_trans 750 985 1.2e-55 PFAM
Pfam:Na_trans_assoc 989 1191 9.1e-57 PFAM
Pfam:Ion_trans 1195 1274 7.6e-16 PFAM
Pfam:Ion_trans 1270 1431 2.6e-33 PFAM
Pfam:Ion_trans 1478 1734 6.5e-55 PFAM
IQ 1851 1873 6e-7 SMART
low complexity region 1912 1931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201518
AA Change: V283A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143879
Gene: ENSMUSG00000023033
AA Change: V283A

DomainStartEndE-ValueType
Pfam:Ion_trans 131 422 8.8e-81 PFAM
low complexity region 423 452 N/A INTRINSIC
Pfam:Na_trans_cytopl 499 700 6.7e-70 PFAM
low complexity region 701 712 N/A INTRINSIC
Pfam:Ion_trans 750 804 5.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201549
AA Change: V283A

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000144013
Gene: ENSMUSG00000023033
AA Change: V283A

DomainStartEndE-ValueType
Pfam:Ion_trans 131 422 7.4e-82 PFAM
low complexity region 423 452 N/A INTRINSIC
Pfam:Na_trans_cytopl 499 700 3.5e-72 PFAM
low complexity region 701 712 N/A INTRINSIC
Pfam:Ion_trans 750 985 2.2e-57 PFAM
Pfam:Na_trans_assoc 989 1191 2e-59 PFAM
Pfam:Ion_trans 1195 1472 6.2e-69 PFAM
Pfam:Ion_trans 1519 1775 1.2e-56 PFAM
IQ 1892 1914 1.2e-4 SMART
low complexity region 1953 1972 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202452
Predicted Effect probably benign
Transcript: ENSMUST00000202702
AA Change: V133A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000143876
Gene: ENSMUSG00000023033
AA Change: V133A

DomainStartEndE-ValueType
Pfam:Ion_trans 1 272 7.9e-75 PFAM
low complexity region 273 302 N/A INTRINSIC
Pfam:Na_trans_cytopl 349 539 9.4e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202971
Meta Mutation Damage Score 0.0948 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium channel alpha subunit gene family. The encoded protein forms the ion pore region of the voltage-gated sodium channel. This protein is essential for the rapid membrane depolarization that occurs during the formation of the action potential in excitable neurons. Mutations in this gene are associated with mental retardation, pancerebellar atrophy and ataxia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: Spontaneous mutant homozygotes have ataxia, dystonia, muscular atrophy, progressive paralysis, Purkinje cell loss, in some cases severe head-tossing and for severe alleles, juvenile lethality. A mild, semidominant ENU allele causes deafness of variable penetrance and severity and mild tremor. [provided by MGI curators]
Allele List at MGI

 All alleles(22) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(6) Transgenic(1) Spontaneous(5) Chemically induced(8)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,329,329 I6N possibly damaging Het
Aen T C 7: 78,905,868 V188A probably damaging Het
Afg3l1 A G 8: 123,501,954 E753G probably damaging Het
Alas1 G A 9: 106,238,660 T385I probably damaging Het
Alms1 C A 6: 85,667,963 probably benign Het
Ankrd65 A G 4: 155,791,411 T30A possibly damaging Het
App T C 16: 84,978,229 S582G probably damaging Het
Arfgef1 A T 1: 10,153,654 V1473E possibly damaging Het
Arhgap21 G A 2: 20,854,998 P1196S probably damaging Het
Arhgap24 A G 5: 102,891,910 T238A probably benign Het
Atf7 T C 15: 102,529,004 probably benign Het
Best1 G T 19: 9,993,311 S55* probably null Het
Capn11 A G 17: 45,633,799 V514A probably damaging Het
Cep104 T A 4: 153,989,146 M52K probably damaging Het
Clca3a1 C T 3: 144,737,858 probably null Het
Cyp3a25 T C 5: 146,003,027 probably null Het
Dmxl2 G A 9: 54,400,094 P2197S probably damaging Het
Drosha T C 15: 12,859,465 probably null Het
Exosc9 A G 3: 36,563,162 K355R probably benign Het
Fut1 A C 7: 45,619,198 H192P probably benign Het
Gm572 T A 4: 148,664,384 V166D possibly damaging Het
Gm9966 C T 7: 95,958,528 P19S unknown Het
Gmds C T 13: 32,100,473 V219I probably damaging Het
Gsn G A 2: 35,283,953 E25K probably benign Het
Il4i1 T C 7: 44,839,891 F368S probably damaging Het
Irak1bp1 T C 9: 82,830,320 L98P probably damaging Het
Khdrbs3 T C 15: 69,024,695 probably benign Het
Kndc1 T C 7: 139,921,822 I925T probably damaging Het
Laptm4a T C 12: 8,938,151 I296T probably benign Het
Lpl A T 8: 68,887,518 H55L probably benign Het
Lrrk2 C A 15: 91,755,927 N1558K probably benign Het
Mfsd2a A G 4: 122,950,487 L289P probably damaging Het
Mmrn2 T A 14: 34,398,802 M543K probably benign Het
Mnat1 T C 12: 73,181,776 probably benign Het
Msto1 A T 3: 88,911,893 probably null Het
Mtus1 A G 8: 41,082,739 Y647H probably damaging Het
Nars A T 18: 64,505,016 V289E probably damaging Het
Oit3 T A 10: 59,428,345 K322N probably damaging Het
Oit3 G A 10: 59,441,685 probably benign Het
Olfr1024 A G 2: 85,904,556 I166T probably benign Het
Olfr1467 T A 19: 13,365,193 C188* probably null Het
Olfr728 T C 14: 50,139,983 I219V probably benign Het
Olfr801 G A 10: 129,670,286 R78W probably damaging Het
Pecr A T 1: 72,277,310 C79S probably damaging Het
Plekhn1 T C 4: 156,222,659 D478G probably damaging Het
Pls1 A T 9: 95,776,563 M264K probably benign Het
Ptprj C A 2: 90,474,996 probably benign Het
Pygm A G 19: 6,397,601 D646G probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Shisa5 T C 9: 109,056,507 probably null Het
Slc10a4 A G 5: 73,008,505 I246V possibly damaging Het
Slc1a1 A T 19: 28,892,912 I104F probably benign Het
Slc22a8 A G 19: 8,610,195 Y511C probably benign Het
Slc6a5 A G 7: 49,956,462 N706S probably benign Het
Sos2 T C 12: 69,650,659 K96E probably damaging Het
Stom G A 2: 35,315,965 R251* probably null Het
Sycp1 T C 3: 102,845,066 E800G probably benign Het
Tab2 G A 10: 7,907,481 P679L probably damaging Het
Tiam2 G A 17: 3,453,382 V945I probably damaging Het
Trpm5 G T 7: 143,074,517 P1007Q probably damaging Het
Uchl1 T G 5: 66,682,613 I139S probably damaging Het
Vmn1r232 A G 17: 20,914,026 I104T possibly damaging Het
Vmn2r97 G A 17: 18,947,552 M689I probably benign Het
Zc3h18 A T 8: 122,403,165 probably benign Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp456 T C 13: 67,362,372 K99R probably benign Het
Other mutations in Scn8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Scn8a APN 15 100955532 unclassified probably benign
IGL00979:Scn8a APN 15 100955406 unclassified probably benign
IGL01339:Scn8a APN 15 101032201 missense probably benign
IGL01992:Scn8a APN 15 100969057 missense probably damaging 1.00
IGL02215:Scn8a APN 15 101029572 splice site probably null
IGL02311:Scn8a APN 15 101013283 missense probably damaging 0.97
IGL02404:Scn8a APN 15 101039730 missense probably damaging 1.00
IGL02652:Scn8a APN 15 101013476 missense probably damaging 0.98
IGL02690:Scn8a APN 15 100970254 missense probably damaging 1.00
IGL02704:Scn8a APN 15 101008062 missense possibly damaging 0.94
IGL03084:Scn8a APN 15 101017172 missense probably damaging 1.00
IGL03108:Scn8a APN 15 100974615 missense probably benign
IGL03224:Scn8a APN 15 101035639 missense probably damaging 1.00
dan UTSW 15 101035624 nonsense probably null
nymph UTSW 15 101035646 missense probably damaging 1.00
Tremord UTSW 15 101013504 missense probably damaging 1.00
3-1:Scn8a UTSW 15 101039939 missense probably benign 0.04
PIT4280001:Scn8a UTSW 15 100957489 missense probably damaging 1.00
PIT4508001:Scn8a UTSW 15 101029692 missense probably damaging 0.98
R0010:Scn8a UTSW 15 101013573 missense probably damaging 1.00
R0010:Scn8a UTSW 15 101013573 missense probably damaging 1.00
R0254:Scn8a UTSW 15 101018364 missense probably damaging 1.00
R0412:Scn8a UTSW 15 101008306 splice site probably benign
R0538:Scn8a UTSW 15 101035624 nonsense probably null
R0539:Scn8a UTSW 15 101016568 missense probably damaging 1.00
R0631:Scn8a UTSW 15 101035537 missense probably damaging 1.00
R0726:Scn8a UTSW 15 100972830 missense probably damaging 1.00
R0945:Scn8a UTSW 15 101015787 missense possibly damaging 0.54
R0967:Scn8a UTSW 15 101035646 missense probably damaging 1.00
R1164:Scn8a UTSW 15 101040162 missense probably benign 0.06
R1283:Scn8a UTSW 15 100969171 missense possibly damaging 0.82
R1368:Scn8a UTSW 15 101035541 missense probably damaging 1.00
R1633:Scn8a UTSW 15 101029815 missense probably benign 0.01
R1669:Scn8a UTSW 15 101011120 missense probably damaging 1.00
R1694:Scn8a UTSW 15 100955528 nonsense probably null
R1735:Scn8a UTSW 15 101015861 missense possibly damaging 0.94
R1773:Scn8a UTSW 15 101039615 missense probably damaging 0.97
R1940:Scn8a UTSW 15 100970204 missense probably benign 0.22
R1996:Scn8a UTSW 15 101024379 missense probably damaging 1.00
R2107:Scn8a UTSW 15 101018363 missense probably damaging 0.99
R2251:Scn8a UTSW 15 101017106 missense probably benign 0.02
R2917:Scn8a UTSW 15 101039732 missense probably damaging 1.00
R3417:Scn8a UTSW 15 100971668 splice site probably benign
R3896:Scn8a UTSW 15 101035498 missense probably benign
R4024:Scn8a UTSW 15 101039793 missense probably damaging 1.00
R4050:Scn8a UTSW 15 101013413 nonsense probably null
R4193:Scn8a UTSW 15 100971603 missense probably damaging 1.00
R4212:Scn8a UTSW 15 100957073 missense possibly damaging 0.88
R4358:Scn8a UTSW 15 100940133 missense probably benign 0.00
R4396:Scn8a UTSW 15 100972830 missense probably damaging 1.00
R4428:Scn8a UTSW 15 100983903 missense probably damaging 1.00
R4452:Scn8a UTSW 15 100957091 missense possibly damaging 0.95
R4631:Scn8a UTSW 15 101016503 nonsense probably null
R4693:Scn8a UTSW 15 101015691 missense probably damaging 1.00
R4765:Scn8a UTSW 15 101040471 missense probably benign 0.07
R4777:Scn8a UTSW 15 101015951 missense probably damaging 1.00
R4949:Scn8a UTSW 15 101029782 missense probably damaging 1.00
R4997:Scn8a UTSW 15 100957054 missense probably damaging 1.00
R5246:Scn8a UTSW 15 101011057 missense probably damaging 1.00
R5566:Scn8a UTSW 15 100974534 missense probably damaging 1.00
R5875:Scn8a UTSW 15 100972822 nonsense probably null
R6031:Scn8a UTSW 15 100983984 missense probably damaging 1.00
R6031:Scn8a UTSW 15 100983984 missense probably damaging 1.00
R6057:Scn8a UTSW 15 100974667 missense possibly damaging 0.94
R6114:Scn8a UTSW 15 101040596 missense probably damaging 0.99
R6362:Scn8a UTSW 15 100940115 splice site probably null
R6535:Scn8a UTSW 15 100959707 intron probably benign
R6677:Scn8a UTSW 15 100969072 missense probably damaging 1.00
R6687:Scn8a UTSW 15 100974627 missense probably benign 0.12
R6701:Scn8a UTSW 15 101040096 missense probably damaging 1.00
R6719:Scn8a UTSW 15 101011015 critical splice acceptor site probably null
R6739:Scn8a UTSW 15 101015955 missense possibly damaging 0.82
R6769:Scn8a UTSW 15 101035564 missense probably benign
R6786:Scn8a UTSW 15 101032215 missense probably benign 0.00
R6849:Scn8a UTSW 15 100955587 splice site probably null
R7108:Scn8a UTSW 15 101039778 missense probably benign 0.01
R7215:Scn8a UTSW 15 101029830 missense possibly damaging 0.80
R7217:Scn8a UTSW 15 100970227 missense probably benign 0.00
R7219:Scn8a UTSW 15 100969103 missense probably damaging 1.00
R7356:Scn8a UTSW 15 100957579 missense probably damaging 1.00
R7479:Scn8a UTSW 15 100955477 missense probably damaging 0.99
R7816:Scn8a UTSW 15 101011036 missense possibly damaging 0.63
R7985:Scn8a UTSW 15 101016962 splice site probably null
R8112:Scn8a UTSW 15 101029837 missense probably benign 0.27
R8263:Scn8a UTSW 15 100983855 missense probably damaging 1.00
R8305:Scn8a UTSW 15 101040506 missense probably benign 0.01
X0066:Scn8a UTSW 15 101040080 missense probably damaging 1.00
X0066:Scn8a UTSW 15 101040081 missense probably damaging 1.00
Z1176:Scn8a UTSW 15 101033518 missense probably damaging 1.00
Z1177:Scn8a UTSW 15 101040222 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGGACCTTAGATTGACTCTGGC -3'
(R):5'- CGGAGACAAGGGAATGGCTTTC -3'

Sequencing Primer
(F):5'- ACCTTAGATTGACTCTGGCTCTGG -3'
(R):5'- AAGCTCCATCTGGCTGCG -3'
Posted On2014-12-04