Incidental Mutation 'R2872:Plin2'
ID253864
Institutional Source Beutler Lab
Gene Symbol Plin2
Ensembl Gene ENSMUSG00000028494
Gene Nameperilipin 2
Synonymsadipophilin, Adrp, Adfp, ADPH
MMRRC Submission 040460-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R2872 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location86648386-86670060 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to G at 86668678 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1 (M1T)
Ref Sequence ENSEMBL: ENSMUSP00000123456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000466] [ENSMUST00000140382] [ENSMUST00000147097] [ENSMUST00000149700]
Predicted Effect probably null
Transcript: ENSMUST00000000466
AA Change: M1T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000000466
Gene: ENSMUSG00000028494
AA Change: M1T

DomainStartEndE-ValueType
Pfam:Perilipin 6 393 5.3e-158 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134094
Predicted Effect probably null
Transcript: ENSMUST00000140382
AA Change: M1T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123456
Gene: ENSMUSG00000028494
AA Change: M1T

DomainStartEndE-ValueType
Pfam:Perilipin 1 196 5.2e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147097
SMART Domains Protein: ENSMUSP00000119063
Gene: ENSMUSG00000028494

DomainStartEndE-ValueType
Pfam:Perilipin 1 157 3.1e-50 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000149700
AA Change: M1T

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123333
Gene: ENSMUSG00000028494
AA Change: M1T

DomainStartEndE-ValueType
Pfam:Perilipin 1 196 5.2e-83 PFAM
Meta Mutation Damage Score 0.6208 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.6%
  • 10x: 94.5%
  • 20x: 80.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the perilipin family, members of which coat intracellular lipid storage droplets. This protein is associated with the lipid globule surface membrane material, and maybe involved in development and maintenance of adipose tissue. However, it is not restricted to adipocytes as previously thought, but is found in a wide range of cultured cell lines, including fibroblasts, endothelial and epithelial cells, and tissues, such as lactating mammary gland, adrenal cortex, Sertoli and Leydig cells, and hepatocytes in alcoholic liver cirrhosis, suggesting that it may serve as a marker of lipid accumulation in diverse cell types and diseases. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygotes for null mutations are resistant to diet-induced obesity and hepatic steatosis and may exhibit altered milk composition, vision abnormalities, or small sebaceous glands. Male mice homozygous for a gene trap allele are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,955,176 C811R possibly damaging Het
AI481877 A C 4: 59,093,850 L226R probably damaging Het
Ak8 T C 2: 28,742,720 I317T possibly damaging Het
Als2 A G 1: 59,211,137 S483P probably damaging Het
Arhgef10 T C 8: 14,975,093 probably null Het
Arhgef10 A G 8: 14,975,666 I459V probably benign Het
Armc2 C T 10: 41,966,700 probably null Het
Atp12a A G 14: 56,386,950 R952G possibly damaging Het
Atp6v1g1 A G 4: 63,550,021 Y87C probably benign Het
Col12a1 A T 9: 79,699,549 F531I probably damaging Het
Csmd2 T C 4: 128,557,718 F113S unknown Het
Ctnnd1 C T 2: 84,620,888 V123I possibly damaging Het
Cyp4a14 C A 4: 115,487,301 G456W probably damaging Het
Cyp4a30b A G 4: 115,458,362 H260R possibly damaging Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Frmpd4 A T X: 167,477,247 D1166E probably benign Het
Gpr156 T A 16: 37,992,223 V307D probably damaging Het
Gpr35 G A 1: 92,983,126 V187I probably benign Het
Gria2 G A 3: 80,702,492 T670I probably damaging Het
Hdac10 G T 15: 89,125,856 Q300K possibly damaging Het
Hdhd2 T C 18: 76,955,006 F44L probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hmcn1 A T 1: 150,738,716 V1313D possibly damaging Het
Ick A T 9: 78,140,100 probably null Het
Ift172 C T 5: 31,257,861 V1335I probably benign Het
Igsf9b A G 9: 27,322,223 I340V probably benign Het
Kif1c A G 11: 70,724,081 E567G probably damaging Het
Klf8 A T X: 153,382,682 E82D probably damaging Het
Matr3 T A 18: 35,572,296 S91R probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mtor T A 4: 148,540,030 M2089K probably benign Het
Myo9b T C 8: 71,290,966 Y224H probably benign Het
Nlrc3 T C 16: 3,957,326 D774G possibly damaging Het
Notum A G 11: 120,660,196 V48A probably benign Het
Nox3 T C 17: 3,682,916 H240R probably damaging Het
Nsun2 A G 13: 69,629,682 T425A probably damaging Het
Olfr1510 T G 14: 52,410,861 T4P probably benign Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Olfr654 T C 7: 104,588,493 S230P possibly damaging Het
Olfr99 A G 17: 37,279,976 V148A possibly damaging Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Otud4 T A 8: 79,661,073 N300K possibly damaging Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Paqr5 A T 9: 61,968,779 probably null Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Pcdhga9 T A 18: 37,737,471 Y118N possibly damaging Het
Pkd1l2 C T 8: 117,038,164 V1332I probably benign Het
Plcl1 A T 1: 55,697,150 D550V probably benign Het
Plekhg1 T G 10: 3,963,982 S1235A probably benign Het
Plekhg5 T A 4: 152,107,503 C433S probably benign Het
Polg2 A G 11: 106,775,425 probably null Het
Ppp1r7 T A 1: 93,357,863 probably null Het
Prdx4 A G X: 155,340,464 V15A probably benign Het
Rapgef6 T A 11: 54,661,175 F956L probably damaging Het
Rasl12 A G 9: 65,408,323 N83S probably benign Het
Rel T C 11: 23,761,129 I13V probably benign Het
Reln C T 5: 22,049,791 V527I possibly damaging Het
Sel1l3 C T 5: 53,137,883 W792* probably null Het
Slc39a8 T A 3: 135,886,793 probably null Het
Slc6a9 T A 4: 117,849,381 M1K probably null Het
Smpdl3a T A 10: 57,802,530 F143Y possibly damaging Het
Spsb4 G T 9: 96,996,018 T84K probably damaging Het
Tbc1d8 A G 1: 39,405,317 F187S probably damaging Het
Tdpoz3 T A 3: 93,826,428 F137I probably benign Het
Tgm7 G A 2: 121,109,693 probably benign Het
Tnni3k C T 3: 154,938,750 probably null Het
Tpd52 A T 3: 9,003,406 Y16* probably null Het
Trpa1 A G 1: 14,887,620 C705R probably damaging Het
Ttn A G 2: 76,750,851 S23233P probably damaging Het
Uevld T C 7: 46,947,945 D154G probably null Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Zfp292 G A 4: 34,808,595 T1483M probably damaging Het
Other mutations in Plin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00826:Plin2 APN 4 86664446 missense possibly damaging 0.88
IGL02501:Plin2 APN 4 86664486 nonsense probably null
IGL02551:Plin2 APN 4 86658692 missense probably benign 0.00
IGL03294:Plin2 APN 4 86662078 missense probably damaging 0.96
R1484:Plin2 UTSW 4 86657244 missense probably benign 0.00
R2165:Plin2 UTSW 4 86668432 missense probably damaging 1.00
R2870:Plin2 UTSW 4 86668678 start codon destroyed probably null 0.99
R2870:Plin2 UTSW 4 86668678 start codon destroyed probably null 0.99
R2871:Plin2 UTSW 4 86668678 start codon destroyed probably null 0.99
R2871:Plin2 UTSW 4 86668678 start codon destroyed probably null 0.99
R2872:Plin2 UTSW 4 86668678 start codon destroyed probably null 0.99
R2873:Plin2 UTSW 4 86668678 start codon destroyed probably null 0.99
R3125:Plin2 UTSW 4 86657144 nonsense probably null
R4948:Plin2 UTSW 4 86661991 missense probably benign 0.00
R5189:Plin2 UTSW 4 86657146 missense probably damaging 1.00
R5563:Plin2 UTSW 4 86662104 missense probably benign 0.01
R6229:Plin2 UTSW 4 86668666 missense probably benign
R6258:Plin2 UTSW 4 86657289 missense probably damaging 0.97
R6260:Plin2 UTSW 4 86657289 missense probably damaging 0.97
R6391:Plin2 UTSW 4 86661999 missense probably null 0.99
R6470:Plin2 UTSW 4 86668370 missense probably damaging 1.00
R6493:Plin2 UTSW 4 86661987 missense possibly damaging 0.80
R6562:Plin2 UTSW 4 86658595 missense probably benign 0.07
R6706:Plin2 UTSW 4 86660120 missense probably benign 0.02
R7310:Plin2 UTSW 4 86668391 missense probably benign 0.03
U24488:Plin2 UTSW 4 86662077 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGTACTGACATAAGCGGAGG -3'
(R):5'- TTGAAAGTGTGTAAACAGCCCTG -3'

Sequencing Primer
(F):5'- GACACAAGGTCGTAGGTAGAGCTC -3'
(R):5'- TGTAAACAGCCCTGGAGCCTC -3'
Posted On2014-12-04