Mutagenetix > Incidental Mutations

Incidental Mutation 'R2516:Nars'

253865

Institutional Source

Beutler Lab

Gene Symbol

Nars

Ensembl Gene

ENSMUSG00000024587

Gene Name

asparaginyl-tRNA synthetase

Synonyms

ASNRS

MMRRC Submission

040420-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.969) question?

Stock #

R2516 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

64499665-64516557 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 64505016 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 289 (V289E)

Ref Sequence

ENSEMBL: ENSMUSP00000025483 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025483]

Predicted Effect

probably damaging
Transcript: ENSMUST00000025483
AA Change: V289E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000025483
Gene: ENSMUSG00000024587
AA Change: V289E

Domain	Start	End	E-Value	Type
coiled coil region	80	112	N/A	INTRINSIC
Pfam:tRNA_anti-codon	139	219	1.2e-12	PFAM
Pfam:tRNA-synt_2	236	554	1.8e-108	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

98% (65/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases are a class of enzymes that charge tRNAs with their cognate amino acids. Asparaginyl-tRNA synthetase is localized to the cytoplasm and belongs to the class II family of tRNA synthetases. The N-terminal domain represents the signature sequence for the eukaryotic asparaginyl-tRNA synthetases. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	A	T	2: 69,329,329	I6N	possibly damaging	Het
Aen	T	C	7: 78,905,868	V188A	probably damaging	Het
Afg3l1	A	G	8: 123,501,954	E753G	probably damaging	Het
Alas1	G	A	9: 106,238,660	T385I	probably damaging	Het
Alms1	C	A	6: 85,667,963		probably benign	Het
Ankrd65	A	G	4: 155,791,411	T30A	possibly damaging	Het
App	T	C	16: 84,978,229	S582G	probably damaging	Het
Arfgef1	A	T	1: 10,153,654	V1473E	possibly damaging	Het
Arhgap21	G	A	2: 20,854,998	P1196S	probably damaging	Het
Arhgap24	A	G	5: 102,891,910	T238A	probably benign	Het
Atf7	T	C	15: 102,529,004		probably benign	Het
Best1	G	T	19: 9,993,311	S55*	probably null	Het
Capn11	A	G	17: 45,633,799	V514A	probably damaging	Het
Cep104	T	A	4: 153,989,146	M52K	probably damaging	Het
Clca3a1	C	T	3: 144,737,858		probably null	Het
Cyp3a25	T	C	5: 146,003,027		probably null	Het
Dmxl2	G	A	9: 54,400,094	P2197S	probably damaging	Het
Drosha	T	C	15: 12,859,465		probably null	Het
Exosc9	A	G	3: 36,563,162	K355R	probably benign	Het
Fut1	A	C	7: 45,619,198	H192P	probably benign	Het
Gm572	T	A	4: 148,664,384	V166D	possibly damaging	Het
Gm9966	C	T	7: 95,958,528	P19S	unknown	Het
Gmds	C	T	13: 32,100,473	V219I	probably damaging	Het
Gsn	G	A	2: 35,283,953	E25K	probably benign	Het
Il4i1	T	C	7: 44,839,891	F368S	probably damaging	Het
Irak1bp1	T	C	9: 82,830,320	L98P	probably damaging	Het
Khdrbs3	T	C	15: 69,024,695		probably benign	Het
Kndc1	T	C	7: 139,921,822	I925T	probably damaging	Het
Laptm4a	T	C	12: 8,938,151	I296T	probably benign	Het
Lpl	A	T	8: 68,887,518	H55L	probably benign	Het
Lrrk2	C	A	15: 91,755,927	N1558K	probably benign	Het
Mfsd2a	A	G	4: 122,950,487	L289P	probably damaging	Het
Mmrn2	T	A	14: 34,398,802	M543K	probably benign	Het
Mnat1	T	C	12: 73,181,776		probably benign	Het
Msto1	A	T	3: 88,911,893		probably null	Het
Mtus1	A	G	8: 41,082,739	Y647H	probably damaging	Het
Oit3	T	A	10: 59,428,345	K322N	probably damaging	Het
Oit3	G	A	10: 59,441,685		probably benign	Het
Olfr1024	A	G	2: 85,904,556	I166T	probably benign	Het
Olfr1467	T	A	19: 13,365,193	C188*	probably null	Het
Olfr728	T	C	14: 50,139,983	I219V	probably benign	Het
Olfr801	G	A	10: 129,670,286	R78W	probably damaging	Het
Pecr	A	T	1: 72,277,310	C79S	probably damaging	Het
Plekhn1	T	C	4: 156,222,659	D478G	probably damaging	Het
Pls1	A	T	9: 95,776,563	M264K	probably benign	Het
Ptprj	C	A	2: 90,474,996		probably benign	Het
Pygm	A	G	19: 6,397,601	D646G	probably benign	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Scn8a	T	C	15: 100,969,162	V283A	probably benign	Het
Shisa5	T	C	9: 109,056,507		probably null	Het
Slc10a4	A	G	5: 73,008,505	I246V	possibly damaging	Het
Slc1a1	A	T	19: 28,892,912	I104F	probably benign	Het
Slc22a8	A	G	19: 8,610,195	Y511C	probably benign	Het
Slc6a5	A	G	7: 49,956,462	N706S	probably benign	Het
Sos2	T	C	12: 69,650,659	K96E	probably damaging	Het
Stom	G	A	2: 35,315,965	R251*	probably null	Het
Sycp1	T	C	3: 102,845,066	E800G	probably benign	Het
Tab2	G	A	10: 7,907,481	P679L	probably damaging	Het
Tiam2	G	A	17: 3,453,382	V945I	probably damaging	Het
Trpm5	G	T	7: 143,074,517	P1007Q	probably damaging	Het
Uchl1	T	G	5: 66,682,613	I139S	probably damaging	Het
Vmn1r232	A	G	17: 20,914,026	I104T	possibly damaging	Het
Vmn2r97	G	A	17: 18,947,552	M689I	probably benign	Het
Zc3h18	A	T	8: 122,403,165		probably benign	Het
Zfhx4	C	T	3: 5,403,358	P2859S	probably benign	Het
Zfp456	T	C	13: 67,362,372	K99R	probably benign	Het

Other mutations in Nars

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01012:Nars	APN	18	64504968	missense	probably damaging	1.00
IGL01962:Nars	APN	18	64510483	missense	probably benign	0.00
IGL01968:Nars	APN	18	64507858	missense	probably damaging	1.00
IGL02288:Nars	APN	18	64510535	splice site	probably benign
IGL02366:Nars	APN	18	64503528	missense	possibly damaging	0.70
IGL02948:Nars	APN	18	64505195	missense	possibly damaging	0.66
FR4976:Nars	UTSW	18	64510445	critical splice donor site	probably benign
R0591:Nars	UTSW	18	64500567	missense	probably damaging	1.00
R1654:Nars	UTSW	18	64512049	missense	probably damaging	1.00
R1691:Nars	UTSW	18	64516414	critical splice donor site	probably null
R1954:Nars	UTSW	18	64500564	missense	probably damaging	1.00
R2006:Nars	UTSW	18	64505028	missense	probably damaging	1.00
R3433:Nars	UTSW	18	64509303	missense	probably damaging	1.00
R4378:Nars	UTSW	18	64501353	missense	probably damaging	1.00
R4667:Nars	UTSW	18	64505231	missense	possibly damaging	0.93
R4737:Nars	UTSW	18	64516427	missense	probably benign
R4877:Nars	UTSW	18	64500572	nonsense	probably null
R5950:Nars	UTSW	18	64510485	missense	possibly damaging	0.91
R6434:Nars	UTSW	18	64507801	missense	probably benign	0.01
R6920:Nars	UTSW	18	64501400	missense	probably damaging	0.99
R7082:Nars	UTSW	18	64504354	missense	possibly damaging	0.68
R7132:Nars	UTSW	18	64507770	critical splice donor site	probably null
R7504:Nars	UTSW	18	64512022	missense	probably benign	0.22
R8120:Nars	UTSW	18	64504351	missense	probably benign	0.19
R8343:Nars	UTSW	18	64504387	missense	probably benign	0.01
R8429:Nars	UTSW	18	64501320	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGAGCCGCTTTGGTAAGAC -3'
(R):5'- TGAAAGCGCGCTCCATGATC -3'

Sequencing Primer
(F):5'- GAGCCGCTTTGGTAAGACAATTAC -3'
(R):5'- CATGATCACCAGGTGTTTCCGG -3'

Posted On

2014-12-04