Incidental Mutation 'R2516:Pygm'
ID253867
Institutional Source Beutler Lab
Gene Symbol Pygm
Ensembl Gene ENSMUSG00000032648
Gene Namemuscle glycogen phosphorylase
SynonymsPG
MMRRC Submission 040420-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2516 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location6384399-6398459 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6397601 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 646 (D646G)
Ref Sequence ENSEMBL: ENSMUSP00000109111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035269] [ENSMUST00000035716] [ENSMUST00000113467] [ENSMUST00000113468] [ENSMUST00000113469] [ENSMUST00000113471] [ENSMUST00000113472] [ENSMUST00000113475] [ENSMUST00000113476] [ENSMUST00000113483] [ENSMUST00000139522] [ENSMUST00000167240] [ENSMUST00000127021] [ENSMUST00000150713] [ENSMUST00000138555] [ENSMUST00000146601] [ENSMUST00000146831]
Predicted Effect probably benign
Transcript: ENSMUST00000035269
AA Change: D734G

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000047564
Gene: ENSMUSG00000032648
AA Change: D734G

DomainStartEndE-ValueType
Pfam:Phosphorylase 113 829 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000035716
SMART Domains Protein: ENSMUSP00000041135
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 126 3.56e-29 SMART
RasGEF 150 388 1.08e-100 SMART
EFh 430 458 8.25e-3 SMART
EFh 459 487 1.42e1 SMART
C1 499 548 3.22e-14 SMART
low complexity region 575 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113467
SMART Domains Protein: ENSMUSP00000109095
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
Blast:RasGEFN 3 24 9e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000113468
SMART Domains Protein: ENSMUSP00000109096
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 97 1.93e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113469
SMART Domains Protein: ENSMUSP00000109097
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
Blast:RasGEFN 3 24 1e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000113471
SMART Domains Protein: ENSMUSP00000109099
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 126 7.2e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113472
SMART Domains Protein: ENSMUSP00000109100
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 126 7.2e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113475
SMART Domains Protein: ENSMUSP00000109103
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 126 7.2e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113476
SMART Domains Protein: ENSMUSP00000109104
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 126 3.56e-29 SMART
RasGEF 150 388 1.08e-100 SMART
EFh 430 458 8.25e-3 SMART
EFh 459 487 1.42e1 SMART
C1 499 548 3.22e-14 SMART
low complexity region 575 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113483
AA Change: D646G

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000109111
Gene: ENSMUSG00000032648
AA Change: D646G

DomainStartEndE-ValueType
Pfam:Phosphorylase 62 742 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123661
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139775
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133968
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145611
Predicted Effect probably benign
Transcript: ENSMUST00000139522
SMART Domains Protein: ENSMUSP00000123036
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 125 6.02e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167240
SMART Domains Protein: ENSMUSP00000129873
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 126 3.56e-29 SMART
RasGEF 150 388 1.08e-100 SMART
EFh 430 458 8.25e-3 SMART
EFh 459 487 1.42e1 SMART
C1 499 548 3.22e-14 SMART
low complexity region 575 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127021
SMART Domains Protein: ENSMUSP00000119740
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
Blast:RasGEFN 3 24 1e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000150713
SMART Domains Protein: ENSMUSP00000120949
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 95 6.73e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138555
SMART Domains Protein: ENSMUSP00000121635
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 126 3.56e-29 SMART
Pfam:RasGEF 151 231 1.6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146601
SMART Domains Protein: ENSMUSP00000117681
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
Blast:RasGEFN 3 58 1e-35 BLAST
SCOP:d1bkds_ 9 58 1e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146831
SMART Domains Protein: ENSMUSP00000120630
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 126 3.56e-29 SMART
Meta Mutation Damage Score 0.1474 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: This gene encodes a glycolysis enzyme found in muscle. Highly similar enzymes encoded by different genes are found in liver and brain. The encoded protein is involved in regulating the breakdown of glycogen to glucose-1-phosphate, which is necessary for ATP generation. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null mutation exhibit massive muscle glycogen accumulation, elevated creatine kinase levels in blood, and very poor exercise performance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,329,329 I6N possibly damaging Het
Aen T C 7: 78,905,868 V188A probably damaging Het
Afg3l1 A G 8: 123,501,954 E753G probably damaging Het
Alas1 G A 9: 106,238,660 T385I probably damaging Het
Alms1 C A 6: 85,667,963 probably benign Het
Ankrd65 A G 4: 155,791,411 T30A possibly damaging Het
App T C 16: 84,978,229 S582G probably damaging Het
Arfgef1 A T 1: 10,153,654 V1473E possibly damaging Het
Arhgap21 G A 2: 20,854,998 P1196S probably damaging Het
Arhgap24 A G 5: 102,891,910 T238A probably benign Het
Atf7 T C 15: 102,529,004 probably benign Het
Best1 G T 19: 9,993,311 S55* probably null Het
Capn11 A G 17: 45,633,799 V514A probably damaging Het
Cep104 T A 4: 153,989,146 M52K probably damaging Het
Clca3a1 C T 3: 144,737,858 probably null Het
Cyp3a25 T C 5: 146,003,027 probably null Het
Dmxl2 G A 9: 54,400,094 P2197S probably damaging Het
Drosha T C 15: 12,859,465 probably null Het
Exosc9 A G 3: 36,563,162 K355R probably benign Het
Fut1 A C 7: 45,619,198 H192P probably benign Het
Gm572 T A 4: 148,664,384 V166D possibly damaging Het
Gm9966 C T 7: 95,958,528 P19S unknown Het
Gmds C T 13: 32,100,473 V219I probably damaging Het
Gsn G A 2: 35,283,953 E25K probably benign Het
Il4i1 T C 7: 44,839,891 F368S probably damaging Het
Irak1bp1 T C 9: 82,830,320 L98P probably damaging Het
Khdrbs3 T C 15: 69,024,695 probably benign Het
Kndc1 T C 7: 139,921,822 I925T probably damaging Het
Laptm4a T C 12: 8,938,151 I296T probably benign Het
Lpl A T 8: 68,887,518 H55L probably benign Het
Lrrk2 C A 15: 91,755,927 N1558K probably benign Het
Mfsd2a A G 4: 122,950,487 L289P probably damaging Het
Mmrn2 T A 14: 34,398,802 M543K probably benign Het
Mnat1 T C 12: 73,181,776 probably benign Het
Msto1 A T 3: 88,911,893 probably null Het
Mtus1 A G 8: 41,082,739 Y647H probably damaging Het
Nars A T 18: 64,505,016 V289E probably damaging Het
Oit3 T A 10: 59,428,345 K322N probably damaging Het
Oit3 G A 10: 59,441,685 probably benign Het
Olfr1024 A G 2: 85,904,556 I166T probably benign Het
Olfr1467 T A 19: 13,365,193 C188* probably null Het
Olfr728 T C 14: 50,139,983 I219V probably benign Het
Olfr801 G A 10: 129,670,286 R78W probably damaging Het
Pecr A T 1: 72,277,310 C79S probably damaging Het
Plekhn1 T C 4: 156,222,659 D478G probably damaging Het
Pls1 A T 9: 95,776,563 M264K probably benign Het
Ptprj C A 2: 90,474,996 probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scn8a T C 15: 100,969,162 V283A probably benign Het
Shisa5 T C 9: 109,056,507 probably null Het
Slc10a4 A G 5: 73,008,505 I246V possibly damaging Het
Slc1a1 A T 19: 28,892,912 I104F probably benign Het
Slc22a8 A G 19: 8,610,195 Y511C probably benign Het
Slc6a5 A G 7: 49,956,462 N706S probably benign Het
Sos2 T C 12: 69,650,659 K96E probably damaging Het
Stom G A 2: 35,315,965 R251* probably null Het
Sycp1 T C 3: 102,845,066 E800G probably benign Het
Tab2 G A 10: 7,907,481 P679L probably damaging Het
Tiam2 G A 17: 3,453,382 V945I probably damaging Het
Trpm5 G T 7: 143,074,517 P1007Q probably damaging Het
Uchl1 T G 5: 66,682,613 I139S probably damaging Het
Vmn1r232 A G 17: 20,914,026 I104T possibly damaging Het
Vmn2r97 G A 17: 18,947,552 M689I probably benign Het
Zc3h18 A T 8: 122,403,165 probably benign Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp456 T C 13: 67,362,372 K99R probably benign Het
Other mutations in Pygm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Pygm APN 19 6391394 missense probably benign
IGL01743:Pygm APN 19 6392994 splice site probably null
IGL01827:Pygm APN 19 6390377 missense probably damaging 1.00
IGL02032:Pygm APN 19 6388087 missense probably benign 0.23
IGL02261:Pygm APN 19 6388271 missense probably damaging 1.00
IGL02431:Pygm APN 19 6388118 missense probably damaging 1.00
IGL02511:Pygm APN 19 6385688 missense probably benign 0.22
IGL02967:Pygm APN 19 6393838 missense probably damaging 1.00
IGL03081:Pygm APN 19 6388821 missense possibly damaging 0.53
R0336:Pygm UTSW 19 6388758 missense probably damaging 1.00
R0415:Pygm UTSW 19 6391366 missense probably benign 0.06
R0799:Pygm UTSW 19 6386018 intron probably benign
R1445:Pygm UTSW 19 6389887 missense probably benign 0.20
R1752:Pygm UTSW 19 6391034 missense probably damaging 0.99
R1828:Pygm UTSW 19 6397607 missense possibly damaging 0.72
R2054:Pygm UTSW 19 6388155 missense probably benign 0.02
R2086:Pygm UTSW 19 6391481 critical splice donor site probably null
R2116:Pygm UTSW 19 6386408 missense probably damaging 0.98
R2431:Pygm UTSW 19 6393785 missense probably damaging 1.00
R3938:Pygm UTSW 19 6392950 missense probably benign 0.42
R4609:Pygm UTSW 19 6391409 missense possibly damaging 0.92
R4924:Pygm UTSW 19 6393724 missense probably damaging 1.00
R4995:Pygm UTSW 19 6398139 missense probably damaging 1.00
R5225:Pygm UTSW 19 6389464 missense probably benign 0.01
R5296:Pygm UTSW 19 6384579 missense probably damaging 1.00
R5437:Pygm UTSW 19 6390382 missense probably damaging 1.00
R5994:Pygm UTSW 19 6398043 critical splice acceptor site probably null
R6030:Pygm UTSW 19 6388812 missense possibly damaging 0.78
R6030:Pygm UTSW 19 6388812 missense possibly damaging 0.78
R6188:Pygm UTSW 19 6397937 splice site probably null
R6266:Pygm UTSW 19 6398139 missense probably damaging 1.00
R6799:Pygm UTSW 19 6398127 missense probably damaging 1.00
R6855:Pygm UTSW 19 6393757 missense probably damaging 1.00
R6856:Pygm UTSW 19 6393757 missense probably damaging 1.00
R6857:Pygm UTSW 19 6393757 missense probably damaging 1.00
R7223:Pygm UTSW 19 6388863 missense probably benign
R7256:Pygm UTSW 19 6385896 missense probably benign 0.01
R7263:Pygm UTSW 19 6388327 missense probably damaging 1.00
R7398:Pygm UTSW 19 6385936 missense probably damaging 1.00
R8093:Pygm UTSW 19 6386042 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGGCCTGAGTGTTTCTATCTAC -3'
(R):5'- AGCTCTGTGAGGTCAAAGGC -3'

Sequencing Primer
(F):5'- CCTGAGTGTTTCTATCTACGAAGTG -3'
(R):5'- AGGTCAAAGGCCAGGTCCTTG -3'
Posted On2014-12-04