Incidental Mutation 'R2516:Slc22a8'
ID253869
Institutional Source Beutler Lab
Gene Symbol Slc22a8
Ensembl Gene ENSMUSG00000063796
Gene Namesolute carrier family 22 (organic anion transporter), member 8
SynonymsRoct, mOat3, OAT3
MMRRC Submission 040420-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2516 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location8591254-8611834 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8610195 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 511 (Y511C)
Ref Sequence ENSEMBL: ENSMUSP00000131045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010251] [ENSMUST00000170817]
Predicted Effect probably benign
Transcript: ENSMUST00000010251
AA Change: Y511C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000010251
Gene: ENSMUSG00000063796
AA Change: Y511C

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:Sugar_tr 73 506 6.8e-33 PFAM
Pfam:MFS_1 97 461 6.7e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170817
AA Change: Y511C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131045
Gene: ENSMUSG00000063796
AA Change: Y511C

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:Sugar_tr 78 507 6.7e-34 PFAM
Pfam:MFS_1 97 461 6.8e-29 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in the sodium-independent transport and excretion of organic anions, some of which are potentially toxic. The encoded protein is an integral membrane protein and appears to be localized to the basolateral membrane of the kidney. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased urinary urate levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,329,329 I6N possibly damaging Het
Aen T C 7: 78,905,868 V188A probably damaging Het
Afg3l1 A G 8: 123,501,954 E753G probably damaging Het
Alas1 G A 9: 106,238,660 T385I probably damaging Het
Alms1 C A 6: 85,667,963 probably benign Het
Ankrd65 A G 4: 155,791,411 T30A possibly damaging Het
App T C 16: 84,978,229 S582G probably damaging Het
Arfgef1 A T 1: 10,153,654 V1473E possibly damaging Het
Arhgap21 G A 2: 20,854,998 P1196S probably damaging Het
Arhgap24 A G 5: 102,891,910 T238A probably benign Het
Atf7 T C 15: 102,529,004 probably benign Het
Best1 G T 19: 9,993,311 S55* probably null Het
Capn11 A G 17: 45,633,799 V514A probably damaging Het
Cep104 T A 4: 153,989,146 M52K probably damaging Het
Clca3a1 C T 3: 144,737,858 probably null Het
Cyp3a25 T C 5: 146,003,027 probably null Het
Dmxl2 G A 9: 54,400,094 P2197S probably damaging Het
Drosha T C 15: 12,859,465 probably null Het
Exosc9 A G 3: 36,563,162 K355R probably benign Het
Fut1 A C 7: 45,619,198 H192P probably benign Het
Gm572 T A 4: 148,664,384 V166D possibly damaging Het
Gm9966 C T 7: 95,958,528 P19S unknown Het
Gmds C T 13: 32,100,473 V219I probably damaging Het
Gsn G A 2: 35,283,953 E25K probably benign Het
Il4i1 T C 7: 44,839,891 F368S probably damaging Het
Irak1bp1 T C 9: 82,830,320 L98P probably damaging Het
Khdrbs3 T C 15: 69,024,695 probably benign Het
Kndc1 T C 7: 139,921,822 I925T probably damaging Het
Laptm4a T C 12: 8,938,151 I296T probably benign Het
Lpl A T 8: 68,887,518 H55L probably benign Het
Lrrk2 C A 15: 91,755,927 N1558K probably benign Het
Mfsd2a A G 4: 122,950,487 L289P probably damaging Het
Mmrn2 T A 14: 34,398,802 M543K probably benign Het
Mnat1 T C 12: 73,181,776 probably benign Het
Msto1 A T 3: 88,911,893 probably null Het
Mtus1 A G 8: 41,082,739 Y647H probably damaging Het
Nars A T 18: 64,505,016 V289E probably damaging Het
Oit3 T A 10: 59,428,345 K322N probably damaging Het
Oit3 G A 10: 59,441,685 probably benign Het
Olfr1024 A G 2: 85,904,556 I166T probably benign Het
Olfr1467 T A 19: 13,365,193 C188* probably null Het
Olfr728 T C 14: 50,139,983 I219V probably benign Het
Olfr801 G A 10: 129,670,286 R78W probably damaging Het
Pecr A T 1: 72,277,310 C79S probably damaging Het
Plekhn1 T C 4: 156,222,659 D478G probably damaging Het
Pls1 A T 9: 95,776,563 M264K probably benign Het
Ptprj C A 2: 90,474,996 probably benign Het
Pygm A G 19: 6,397,601 D646G probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scn8a T C 15: 100,969,162 V283A probably benign Het
Shisa5 T C 9: 109,056,507 probably null Het
Slc10a4 A G 5: 73,008,505 I246V possibly damaging Het
Slc1a1 A T 19: 28,892,912 I104F probably benign Het
Slc6a5 A G 7: 49,956,462 N706S probably benign Het
Sos2 T C 12: 69,650,659 K96E probably damaging Het
Stom G A 2: 35,315,965 R251* probably null Het
Sycp1 T C 3: 102,845,066 E800G probably benign Het
Tab2 G A 10: 7,907,481 P679L probably damaging Het
Tiam2 G A 17: 3,453,382 V945I probably damaging Het
Trpm5 G T 7: 143,074,517 P1007Q probably damaging Het
Uchl1 T G 5: 66,682,613 I139S probably damaging Het
Vmn1r232 A G 17: 20,914,026 I104T possibly damaging Het
Vmn2r97 G A 17: 18,947,552 M689I probably benign Het
Zc3h18 A T 8: 122,403,165 probably benign Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp456 T C 13: 67,362,372 K99R probably benign Het
Other mutations in Slc22a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Slc22a8 APN 19 8594135 missense probably benign 0.37
IGL00679:Slc22a8 APN 19 8604855 missense possibly damaging 0.54
IGL00717:Slc22a8 APN 19 8609929 missense probably benign 0.02
IGL00974:Slc22a8 APN 19 8609926 missense probably damaging 1.00
IGL01104:Slc22a8 APN 19 8607965 missense possibly damaging 0.62
IGL01975:Slc22a8 APN 19 8605411 missense probably damaging 0.96
IGL02025:Slc22a8 APN 19 8594175 missense possibly damaging 0.65
IGL02353:Slc22a8 APN 19 8608255 missense possibly damaging 0.78
IGL02360:Slc22a8 APN 19 8608255 missense possibly damaging 0.78
IGL02535:Slc22a8 APN 19 8610203 missense probably benign
IGL02639:Slc22a8 APN 19 8593959 missense probably benign
IGL03167:Slc22a8 APN 19 8609958 missense probably damaging 1.00
IGL03368:Slc22a8 APN 19 8609119 splice site probably benign
R0333:Slc22a8 UTSW 19 8608150 splice site probably benign
R1290:Slc22a8 UTSW 19 8609911 missense probably damaging 1.00
R1773:Slc22a8 UTSW 19 8594229 missense probably damaging 1.00
R1861:Slc22a8 UTSW 19 8606139 missense probably damaging 1.00
R2988:Slc22a8 UTSW 19 8610248 missense probably benign 0.00
R3914:Slc22a8 UTSW 19 8608186 missense probably damaging 1.00
R4206:Slc22a8 UTSW 19 8608233 missense probably benign 0.00
R5092:Slc22a8 UTSW 19 8594164 missense probably damaging 1.00
R5463:Slc22a8 UTSW 19 8609274 missense probably benign 0.00
R5470:Slc22a8 UTSW 19 8607870 missense probably damaging 1.00
R6733:Slc22a8 UTSW 19 8609292 missense probably benign 0.01
R7009:Slc22a8 UTSW 19 8605417 missense probably benign 0.05
R7642:Slc22a8 UTSW 19 8610045 missense probably benign 0.00
R7684:Slc22a8 UTSW 19 8609930 missense probably benign 0.00
R7689:Slc22a8 UTSW 19 8607884 missense probably damaging 0.96
R7729:Slc22a8 UTSW 19 8593959 missense possibly damaging 0.95
R7879:Slc22a8 UTSW 19 8594022 missense probably benign 0.11
R8030:Slc22a8 UTSW 19 8610007 missense probably damaging 0.99
R8113:Slc22a8 UTSW 19 8605539 missense probably benign 0.00
R8280:Slc22a8 UTSW 19 8609263 nonsense probably null
R8509:Slc22a8 UTSW 19 8607975 critical splice donor site probably null
Z1176:Slc22a8 UTSW 19 8593922 missense probably benign 0.10
Z1177:Slc22a8 UTSW 19 8605423 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TTGGGACCATGACTCTACTGG -3'
(R):5'- AGAAGTCTTTGTTCTGAGAGCATG -3'

Sequencing Primer
(F):5'- ACCATGACTCTACTGGGAGGC -3'
(R):5'- CATGGAGCCAGCTGGGG -3'
Posted On2014-12-04