Incidental Mutation 'R2516:Olfr1467'
ID253873
Institutional Source Beutler Lab
Gene Symbol Olfr1467
Ensembl Gene ENSMUSG00000049015
Gene Nameolfactory receptor 1467
SynonymsMOR202-15, GA_x6K02T2RE5P-3695694-3696620
MMRRC Submission 040420-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R2516 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location13362236-13368054 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 13365193 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 188 (C188*)
Ref Sequence ENSEMBL: ENSMUSP00000149487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054687] [ENSMUST00000215096]
Predicted Effect probably null
Transcript: ENSMUST00000054687
AA Change: C188*
SMART Domains Protein: ENSMUSP00000061580
Gene: ENSMUSG00000049015
AA Change: C188*

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 6.6e-48 PFAM
Pfam:7tm_1 40 289 7.4e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000215096
AA Change: C188*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,329,329 I6N possibly damaging Het
Aen T C 7: 78,905,868 V188A probably damaging Het
Afg3l1 A G 8: 123,501,954 E753G probably damaging Het
Alas1 G A 9: 106,238,660 T385I probably damaging Het
Alms1 C A 6: 85,667,963 probably benign Het
Ankrd65 A G 4: 155,791,411 T30A possibly damaging Het
App T C 16: 84,978,229 S582G probably damaging Het
Arfgef1 A T 1: 10,153,654 V1473E possibly damaging Het
Arhgap21 G A 2: 20,854,998 P1196S probably damaging Het
Arhgap24 A G 5: 102,891,910 T238A probably benign Het
Atf7 T C 15: 102,529,004 probably benign Het
Best1 G T 19: 9,993,311 S55* probably null Het
Capn11 A G 17: 45,633,799 V514A probably damaging Het
Cep104 T A 4: 153,989,146 M52K probably damaging Het
Clca3a1 C T 3: 144,737,858 probably null Het
Cyp3a25 T C 5: 146,003,027 probably null Het
Dmxl2 G A 9: 54,400,094 P2197S probably damaging Het
Drosha T C 15: 12,859,465 probably null Het
Exosc9 A G 3: 36,563,162 K355R probably benign Het
Fut1 A C 7: 45,619,198 H192P probably benign Het
Gm572 T A 4: 148,664,384 V166D possibly damaging Het
Gm9966 C T 7: 95,958,528 P19S unknown Het
Gmds C T 13: 32,100,473 V219I probably damaging Het
Gsn G A 2: 35,283,953 E25K probably benign Het
Il4i1 T C 7: 44,839,891 F368S probably damaging Het
Irak1bp1 T C 9: 82,830,320 L98P probably damaging Het
Khdrbs3 T C 15: 69,024,695 probably benign Het
Kndc1 T C 7: 139,921,822 I925T probably damaging Het
Laptm4a T C 12: 8,938,151 I296T probably benign Het
Lpl A T 8: 68,887,518 H55L probably benign Het
Lrrk2 C A 15: 91,755,927 N1558K probably benign Het
Mfsd2a A G 4: 122,950,487 L289P probably damaging Het
Mmrn2 T A 14: 34,398,802 M543K probably benign Het
Mnat1 T C 12: 73,181,776 probably benign Het
Msto1 A T 3: 88,911,893 probably null Het
Mtus1 A G 8: 41,082,739 Y647H probably damaging Het
Nars A T 18: 64,505,016 V289E probably damaging Het
Oit3 T A 10: 59,428,345 K322N probably damaging Het
Oit3 G A 10: 59,441,685 probably benign Het
Olfr1024 A G 2: 85,904,556 I166T probably benign Het
Olfr728 T C 14: 50,139,983 I219V probably benign Het
Olfr801 G A 10: 129,670,286 R78W probably damaging Het
Pecr A T 1: 72,277,310 C79S probably damaging Het
Plekhn1 T C 4: 156,222,659 D478G probably damaging Het
Pls1 A T 9: 95,776,563 M264K probably benign Het
Ptprj C A 2: 90,474,996 probably benign Het
Pygm A G 19: 6,397,601 D646G probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scn8a T C 15: 100,969,162 V283A probably benign Het
Shisa5 T C 9: 109,056,507 probably null Het
Slc10a4 A G 5: 73,008,505 I246V possibly damaging Het
Slc1a1 A T 19: 28,892,912 I104F probably benign Het
Slc22a8 A G 19: 8,610,195 Y511C probably benign Het
Slc6a5 A G 7: 49,956,462 N706S probably benign Het
Sos2 T C 12: 69,650,659 K96E probably damaging Het
Stom G A 2: 35,315,965 R251* probably null Het
Sycp1 T C 3: 102,845,066 E800G probably benign Het
Tab2 G A 10: 7,907,481 P679L probably damaging Het
Tiam2 G A 17: 3,453,382 V945I probably damaging Het
Trpm5 G T 7: 143,074,517 P1007Q probably damaging Het
Uchl1 T G 5: 66,682,613 I139S probably damaging Het
Vmn1r232 A G 17: 20,914,026 I104T possibly damaging Het
Vmn2r97 G A 17: 18,947,552 M689I probably benign Het
Zc3h18 A T 8: 122,403,165 probably benign Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp456 T C 13: 67,362,372 K99R probably benign Het
Other mutations in Olfr1467
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00936:Olfr1467 APN 19 13364624 utr 5 prime probably benign
IGL01109:Olfr1467 APN 19 13364699 missense probably benign
IGL01939:Olfr1467 APN 19 13365443 missense probably benign 0.14
IGL02188:Olfr1467 APN 19 13365032 missense probably benign 0.39
IGL02188:Olfr1467 APN 19 13365279 missense probably damaging 0.98
IGL03223:Olfr1467 APN 19 13365281 missense probably benign
R0456:Olfr1467 UTSW 19 13364738 missense probably damaging 0.98
R1066:Olfr1467 UTSW 19 13365087 missense probably benign
R1189:Olfr1467 UTSW 19 13365179 missense probably benign 0.03
R1668:Olfr1467 UTSW 19 13364870 missense probably benign 0.00
R1754:Olfr1467 UTSW 19 13365353 missense probably damaging 1.00
R1860:Olfr1467 UTSW 19 13365341 missense possibly damaging 0.80
R1861:Olfr1467 UTSW 19 13365341 missense possibly damaging 0.80
R2181:Olfr1467 UTSW 19 13365074 missense probably benign 0.08
R2219:Olfr1467 UTSW 19 13365537 missense possibly damaging 0.88
R4757:Olfr1467 UTSW 19 13365446 missense probably benign 0.23
R5206:Olfr1467 UTSW 19 13365065 missense possibly damaging 0.91
R5376:Olfr1467 UTSW 19 13365398 missense possibly damaging 0.95
R5647:Olfr1467 UTSW 19 13365177 missense probably damaging 1.00
R5724:Olfr1467 UTSW 19 13365151 missense possibly damaging 0.62
R5741:Olfr1467 UTSW 19 13365483 missense probably damaging 0.97
R5906:Olfr1467 UTSW 19 13365005 missense probably damaging 1.00
R6636:Olfr1467 UTSW 19 13365225 missense probably benign 0.06
R6637:Olfr1467 UTSW 19 13365225 missense probably benign 0.06
R7000:Olfr1467 UTSW 19 13364623 start gained probably benign
R7254:Olfr1467 UTSW 19 13365111 missense probably benign 0.28
R7325:Olfr1467 UTSW 19 13364637 missense probably benign 0.00
R7773:Olfr1467 UTSW 19 13365234 missense probably benign 0.07
R7828:Olfr1467 UTSW 19 13365146 missense probably benign 0.10
Z1176:Olfr1467 UTSW 19 13364915 missense probably damaging 1.00
Z1176:Olfr1467 UTSW 19 13364916 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCACCATGACTACAAGTGTG -3'
(R):5'- AGAGTGATTGGAACTTGGCTGTAC -3'

Sequencing Primer
(F):5'- CACCATGACTACAAGTGTGTGTACG -3'
(R):5'- TGGAGACTGCAGTGAAGTG -3'
Posted On2014-12-04