Incidental Mutation 'R2517:Ubr3'
ID253889
Institutional Source Beutler Lab
Gene Symbol Ubr3
Ensembl Gene ENSMUSG00000044308
Gene Nameubiquitin protein ligase E3 component n-recognin 3
SynonymsZfp650, 4833421P10Rik, A130030D10Rik, 1110059H15Rik
MMRRC Submission 040421-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2517 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location69897246-70024013 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 69936018 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 410 (Y410F)
Ref Sequence ENSEMBL: ENSMUSP00000107870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055758] [ENSMUST00000112251]
Predicted Effect probably damaging
Transcript: ENSMUST00000055758
AA Change: Y411F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000060159
Gene: ENSMUSG00000044308
AA Change: Y411F

DomainStartEndE-ValueType
low complexity region 13 40 N/A INTRINSIC
low complexity region 67 88 N/A INTRINSIC
Pfam:zf-UBR 118 188 1.6e-19 PFAM
low complexity region 339 354 N/A INTRINSIC
low complexity region 570 580 N/A INTRINSIC
low complexity region 1016 1027 N/A INTRINSIC
low complexity region 1082 1101 N/A INTRINSIC
coiled coil region 1167 1199 N/A INTRINSIC
Blast:RING 1289 1363 8e-39 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000112251
AA Change: Y410F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107870
Gene: ENSMUSG00000044308
AA Change: Y410F

DomainStartEndE-ValueType
low complexity region 13 40 N/A INTRINSIC
low complexity region 67 88 N/A INTRINSIC
Pfam:zf-UBR 119 187 1.7e-21 PFAM
low complexity region 338 353 N/A INTRINSIC
low complexity region 569 579 N/A INTRINSIC
low complexity region 1015 1026 N/A INTRINSIC
low complexity region 1081 1100 N/A INTRINSIC
coiled coil region 1166 1198 N/A INTRINSIC
Blast:RING 1288 1362 8e-39 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000131553
AA Change: Y407F
SMART Domains Protein: ENSMUSP00000121401
Gene: ENSMUSG00000044308
AA Change: Y407F

DomainStartEndE-ValueType
low complexity region 11 38 N/A INTRINSIC
low complexity region 65 86 N/A INTRINSIC
Pfam:zf-UBR 117 185 1.2e-21 PFAM
low complexity region 336 351 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142563
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice obtained on a coisogenic 129S1 background die early in embryogenesis while those on a mixed 129S1/B6 background are born at a slightly reduced frequency. On a congenic C57BL/6 background, homozygotes display neonatal lethality, impaired suckling and female behavioral anosmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700042G07Rik A G 4: 116,173,594 D65G probably benign Het
Adcy4 C A 14: 55,781,946 E82D probably damaging Het
AF067061 T A 13: 120,263,939 C46* probably null Het
Ago1 G A 4: 126,439,939 R486* probably null Het
Ago2 T A 15: 73,124,242 N346I possibly damaging Het
Apol11a A T 15: 77,517,195 D294V probably benign Het
Atp13a5 A G 16: 29,297,397 F634L possibly damaging Het
Atp2a2 G A 5: 122,457,513 P953L probably damaging Het
Brca2 A G 5: 150,539,672 D967G probably benign Het
Bud13 A T 9: 46,288,148 H269L probably benign Het
Cachd1 A T 4: 100,980,882 probably null Het
Cog3 T C 14: 75,741,742 D188G probably benign Het
Col15a1 T C 4: 47,208,492 S20P probably damaging Het
Col4a3 A G 1: 82,680,710 D838G unknown Het
Cwh43 A T 5: 73,421,543 T298S probably benign Het
Dip2c A G 13: 9,609,005 R847G probably damaging Het
Dnah2 C T 11: 69,516,644 D438N probably damaging Het
Drg2 T C 11: 60,468,128 V358A probably damaging Het
Eif4enif1 T A 11: 3,221,168 W220R probably damaging Het
Enpp2 A T 15: 54,919,694 I75K probably damaging Het
Fam110c T C 12: 31,075,239 I400T probably damaging Het
Fam193b C A 13: 55,542,816 R711L probably damaging Het
Fgfr1 T C 8: 25,563,446 Y246H probably damaging Het
Frs3 G A 17: 47,703,072 R230Q probably benign Het
Galnt5 A G 2: 57,999,413 K342E probably benign Het
Glrb A T 3: 80,861,747 L189Q probably damaging Het
Gmeb2 T C 2: 181,259,026 T193A probably benign Het
Gnl3 A G 14: 31,014,163 S307P probably damaging Het
Golim4 A T 3: 75,892,859 F443I probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Klf10 A C 15: 38,297,113 Y228D probably benign Het
Klrc3 A T 6: 129,639,557 W166R probably damaging Het
Kng2 A T 16: 22,988,315 I378N probably benign Het
Map3k10 T C 7: 27,663,263 K466R possibly damaging Het
Mrrf C T 2: 36,189,097 T245M probably benign Het
Msi1 A G 5: 115,445,458 Y239C probably damaging Het
Nfasc A G 1: 132,597,763 probably null Het
Olfr1375 T A 11: 51,048,473 L122Q probably damaging Het
Olfr843 A T 9: 19,249,061 C113S probably benign Het
Pkd1l1 T C 11: 8,958,900 E368G unknown Het
Polq G A 16: 37,089,325 G2078D probably damaging Het
Ppfibp1 A C 6: 146,992,444 I134L probably damaging Het
Rasip1 A T 7: 45,634,823 I608F probably damaging Het
Ripk3 A T 14: 55,788,035 V24E probably damaging Het
Rtkn T A 6: 83,147,545 I110N probably damaging Het
Scn1a C T 2: 66,273,832 V1695I probably damaging Het
Shank2 A G 7: 144,052,305 N75S possibly damaging Het
Snu13 C A 15: 82,043,981 A14S probably benign Het
Snx27 A C 3: 94,531,234 D231E probably damaging Het
Spef2 A G 15: 9,725,197 I158T possibly damaging Het
Sptb A G 12: 76,649,869 I19T possibly damaging Het
Ssu72 T C 4: 155,733,513 L175P probably damaging Het
Tecr C T 8: 83,572,575 V248I probably benign Het
Tnfrsf13b T G 11: 61,141,476 S59A probably benign Het
Tom1l1 T C 11: 90,671,125 T150A possibly damaging Het
Vmn2r108 A G 17: 20,472,315 I93T probably damaging Het
Vmn2r19 A G 6: 123,329,978 T482A probably benign Het
Vstm4 T A 14: 32,863,707 M77K probably benign Het
Zbtb17 C T 4: 141,464,585 T309I probably damaging Het
Zfp957 T C 14: 79,214,054 T102A probably damaging Het
Other mutations in Ubr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Ubr3 APN 2 69988810 missense probably benign 0.40
IGL00985:Ubr3 APN 2 70003431 missense probably damaging 1.00
IGL01061:Ubr3 APN 2 69983225 missense probably benign 0.05
IGL01325:Ubr3 APN 2 69917097 missense possibly damaging 0.71
IGL01398:Ubr3 APN 2 69959653 missense probably damaging 1.00
IGL01484:Ubr3 APN 2 70021544 nonsense probably null
IGL01599:Ubr3 APN 2 69938178 missense probably damaging 1.00
IGL01616:Ubr3 APN 2 70020484 missense probably benign 0.14
IGL01634:Ubr3 APN 2 69973572 missense probably benign
IGL01684:Ubr3 APN 2 70016158 nonsense probably null
IGL01810:Ubr3 APN 2 70003465 splice site probably null
IGL01813:Ubr3 APN 2 69951570 missense probably benign 0.34
IGL01994:Ubr3 APN 2 70021176 missense probably damaging 1.00
IGL02188:Ubr3 APN 2 69959611 nonsense probably null
IGL02318:Ubr3 APN 2 69979397 missense probably damaging 1.00
IGL02379:Ubr3 APN 2 69948488 missense possibly damaging 0.91
IGL02635:Ubr3 APN 2 70020483 missense probably damaging 0.96
IGL02858:Ubr3 APN 2 69952859 missense probably damaging 1.00
IGL03140:Ubr3 APN 2 69970189 missense probably damaging 1.00
IGL03343:Ubr3 APN 2 69973146 splice site probably benign
Hyrax UTSW 2 69952868 missense probably benign 0.32
manatee UTSW 2 69979386 nonsense probably null
sea_cow UTSW 2 69959669 splice site probably null
R0094:Ubr3 UTSW 2 69951362 missense probably damaging 1.00
R0094:Ubr3 UTSW 2 69951362 missense probably damaging 1.00
R0122:Ubr3 UTSW 2 69979412 missense probably damaging 1.00
R0243:Ubr3 UTSW 2 69951405 missense probably damaging 1.00
R0710:Ubr3 UTSW 2 69952837 missense probably damaging 1.00
R0787:Ubr3 UTSW 2 69951421 splice site probably benign
R1137:Ubr3 UTSW 2 69938315 splice site probably benign
R1191:Ubr3 UTSW 2 70021181 nonsense probably null
R1416:Ubr3 UTSW 2 69945071 missense probably damaging 1.00
R1623:Ubr3 UTSW 2 69977723 nonsense probably null
R1735:Ubr3 UTSW 2 70009129 missense probably damaging 1.00
R1789:Ubr3 UTSW 2 70016367 missense possibly damaging 0.87
R1793:Ubr3 UTSW 2 70000551 splice site probably benign
R1932:Ubr3 UTSW 2 69953476 splice site probably null
R2042:Ubr3 UTSW 2 69977774 nonsense probably null
R2085:Ubr3 UTSW 2 69953764 missense probably damaging 1.00
R2090:Ubr3 UTSW 2 69936017 missense probably damaging 1.00
R2112:Ubr3 UTSW 2 69977792 missense possibly damaging 0.73
R2173:Ubr3 UTSW 2 69897399 missense probably benign
R2215:Ubr3 UTSW 2 69979317 critical splice acceptor site probably null
R2273:Ubr3 UTSW 2 70016341 missense probably benign 0.11
R2274:Ubr3 UTSW 2 70016341 missense probably benign 0.11
R2275:Ubr3 UTSW 2 70016341 missense probably benign 0.11
R2292:Ubr3 UTSW 2 69897260 unclassified probably benign
R2447:Ubr3 UTSW 2 70003380 missense probably damaging 1.00
R2504:Ubr3 UTSW 2 69938198 missense probably damaging 0.99
R2901:Ubr3 UTSW 2 70016192 missense possibly damaging 0.89
R3109:Ubr3 UTSW 2 69988840 missense probably damaging 1.00
R3737:Ubr3 UTSW 2 69971234 critical splice donor site probably null
R3793:Ubr3 UTSW 2 69917181 missense possibly damaging 0.95
R3821:Ubr3 UTSW 2 69993813 critical splice donor site probably null
R3918:Ubr3 UTSW 2 70016130 critical splice acceptor site probably null
R4157:Ubr3 UTSW 2 69959669 splice site probably null
R4235:Ubr3 UTSW 2 70016385 nonsense probably null
R4276:Ubr3 UTSW 2 69938387 nonsense probably null
R4544:Ubr3 UTSW 2 69956093 missense probably benign 0.18
R4678:Ubr3 UTSW 2 69935919 missense probably damaging 1.00
R4707:Ubr3 UTSW 2 69938370 intron probably benign
R4785:Ubr3 UTSW 2 69959603 missense probably damaging 1.00
R4872:Ubr3 UTSW 2 69970183 missense probably damaging 1.00
R4887:Ubr3 UTSW 2 70013131 missense probably damaging 0.99
R4920:Ubr3 UTSW 2 69952868 missense probably benign 0.32
R4989:Ubr3 UTSW 2 70020446 splice site probably benign
R5104:Ubr3 UTSW 2 69938256 missense probably damaging 0.98
R5134:Ubr3 UTSW 2 70020446 splice site probably benign
R5137:Ubr3 UTSW 2 69973335 missense probably damaging 1.00
R5174:Ubr3 UTSW 2 70009162 missense probably damaging 1.00
R5195:Ubr3 UTSW 2 69956034 missense probably benign 0.00
R5437:Ubr3 UTSW 2 69944390 missense probably damaging 1.00
R5539:Ubr3 UTSW 2 70020533 missense probably damaging 1.00
R5781:Ubr3 UTSW 2 70016244 splice site probably null
R5809:Ubr3 UTSW 2 69965511 missense possibly damaging 0.90
R5913:Ubr3 UTSW 2 70021215 missense probably damaging 1.00
R5969:Ubr3 UTSW 2 69979386 nonsense probably null
R6136:Ubr3 UTSW 2 69993763 missense probably benign 0.26
R6140:Ubr3 UTSW 2 69973329 missense probably benign 0.09
R6185:Ubr3 UTSW 2 69938277 missense probably damaging 0.98
R6220:Ubr3 UTSW 2 70020475 missense probably damaging 1.00
R6258:Ubr3 UTSW 2 69982864 intron probably null
R6319:Ubr3 UTSW 2 69973414 missense probably benign 0.00
R6322:Ubr3 UTSW 2 69956085 nonsense probably null
R6470:Ubr3 UTSW 2 69965460 missense probably benign 0.02
R6477:Ubr3 UTSW 2 69979429 nonsense probably null
R6702:Ubr3 UTSW 2 69956049 missense probably benign 0.23
R6709:Ubr3 UTSW 2 70013092 missense probably damaging 1.00
R6803:Ubr3 UTSW 2 69936024 critical splice donor site probably null
R6806:Ubr3 UTSW 2 69955964 splice site probably benign
R6834:Ubr3 UTSW 2 70000481 missense possibly damaging 0.63
R6841:Ubr3 UTSW 2 70020625 missense probably damaging 1.00
R6847:Ubr3 UTSW 2 69983128 missense probably damaging 1.00
R6889:Ubr3 UTSW 2 69944300 missense possibly damaging 0.70
R7065:Ubr3 UTSW 2 69953705 missense probably damaging 1.00
R7102:Ubr3 UTSW 2 69897822 missense probably damaging 1.00
R7156:Ubr3 UTSW 2 70021623 missense probably damaging 1.00
R7209:Ubr3 UTSW 2 70016134 missense probably benign 0.01
R7273:Ubr3 UTSW 2 69979333 missense probably damaging 0.97
R7314:Ubr3 UTSW 2 69991600 missense probably damaging 1.00
R7422:Ubr3 UTSW 2 69953542 critical splice donor site probably null
R7584:Ubr3 UTSW 2 69991503 missense probably damaging 1.00
R7588:Ubr3 UTSW 2 69971169 missense probably damaging 1.00
R7597:Ubr3 UTSW 2 69973468 missense possibly damaging 0.69
R7697:Ubr3 UTSW 2 69897686 missense probably damaging 1.00
Z1088:Ubr3 UTSW 2 69922367 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTACTTTCAGATGAGTTTGATGGAC -3'
(R):5'- GCTAAGATTCTGTGTATTCCGAGC -3'

Sequencing Primer
(F):5'- TATGGCAAGGTTTAAATGACATGAGC -3'
(R):5'- GTGTATTCCGAGCAGACGTTCAAC -3'
Posted On2014-12-04