Incidental Mutation 'R2517:Gmeb2'
ID253893
Institutional Source Beutler Lab
Gene Symbol Gmeb2
Ensembl Gene ENSMUSG00000038705
Gene Nameglucocorticoid modulatory element binding protein 2
Synonyms
MMRRC Submission 040421-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R2517 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location181251449-181288035 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 181259026 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 193 (T193A)
Ref Sequence ENSEMBL: ENSMUSP00000116479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049032] [ENSMUST00000130475] [ENSMUST00000141003] [ENSMUST00000141110]
Predicted Effect probably benign
Transcript: ENSMUST00000049032
AA Change: T193A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000037075
Gene: ENSMUSG00000038705
AA Change: T193A

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
SAND 90 163 1.66e-42 SMART
coiled coil region 304 347 N/A INTRINSIC
low complexity region 414 426 N/A INTRINSIC
low complexity region 475 488 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123148
Predicted Effect probably benign
Transcript: ENSMUST00000130475
AA Change: T193A

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000116479
Gene: ENSMUSG00000038705
AA Change: T193A

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
SAND 90 163 1.66e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141003
SMART Domains Protein: ENSMUSP00000116854
Gene: ENSMUSG00000038705

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
Pfam:SAND 81 126 7.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141110
SMART Domains Protein: ENSMUSP00000115853
Gene: ENSMUSG00000038705

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of KDWK gene family. The product of this gene associates with GMEB1 protein, and the complex is essential for parvovirus DNA replication. Study of rat homolog implicates the role of this gene in modulation of transactivation by the glucocorticoid receptor bound to glucocorticoid response elements. This gene appears to use multiple polyadenylation sites. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700042G07Rik A G 4: 116,173,594 D65G probably benign Het
Adcy4 C A 14: 55,781,946 E82D probably damaging Het
AF067061 T A 13: 120,263,939 C46* probably null Het
Ago1 G A 4: 126,439,939 R486* probably null Het
Ago2 T A 15: 73,124,242 N346I possibly damaging Het
Apol11a A T 15: 77,517,195 D294V probably benign Het
Atp13a5 A G 16: 29,297,397 F634L possibly damaging Het
Atp2a2 G A 5: 122,457,513 P953L probably damaging Het
Brca2 A G 5: 150,539,672 D967G probably benign Het
Bud13 A T 9: 46,288,148 H269L probably benign Het
Cachd1 A T 4: 100,980,882 probably null Het
Cog3 T C 14: 75,741,742 D188G probably benign Het
Col15a1 T C 4: 47,208,492 S20P probably damaging Het
Col4a3 A G 1: 82,680,710 D838G unknown Het
Cwh43 A T 5: 73,421,543 T298S probably benign Het
Dip2c A G 13: 9,609,005 R847G probably damaging Het
Dnah2 C T 11: 69,516,644 D438N probably damaging Het
Drg2 T C 11: 60,468,128 V358A probably damaging Het
Eif4enif1 T A 11: 3,221,168 W220R probably damaging Het
Enpp2 A T 15: 54,919,694 I75K probably damaging Het
Fam110c T C 12: 31,075,239 I400T probably damaging Het
Fam193b C A 13: 55,542,816 R711L probably damaging Het
Fgfr1 T C 8: 25,563,446 Y246H probably damaging Het
Frs3 G A 17: 47,703,072 R230Q probably benign Het
Galnt5 A G 2: 57,999,413 K342E probably benign Het
Glrb A T 3: 80,861,747 L189Q probably damaging Het
Gnl3 A G 14: 31,014,163 S307P probably damaging Het
Golim4 A T 3: 75,892,859 F443I probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Klf10 A C 15: 38,297,113 Y228D probably benign Het
Klrc3 A T 6: 129,639,557 W166R probably damaging Het
Kng2 A T 16: 22,988,315 I378N probably benign Het
Map3k10 T C 7: 27,663,263 K466R possibly damaging Het
Mrrf C T 2: 36,189,097 T245M probably benign Het
Msi1 A G 5: 115,445,458 Y239C probably damaging Het
Nfasc A G 1: 132,597,763 probably null Het
Olfr1375 T A 11: 51,048,473 L122Q probably damaging Het
Olfr843 A T 9: 19,249,061 C113S probably benign Het
Pkd1l1 T C 11: 8,958,900 E368G unknown Het
Polq G A 16: 37,089,325 G2078D probably damaging Het
Ppfibp1 A C 6: 146,992,444 I134L probably damaging Het
Rasip1 A T 7: 45,634,823 I608F probably damaging Het
Ripk3 A T 14: 55,788,035 V24E probably damaging Het
Rtkn T A 6: 83,147,545 I110N probably damaging Het
Scn1a C T 2: 66,273,832 V1695I probably damaging Het
Shank2 A G 7: 144,052,305 N75S possibly damaging Het
Snu13 C A 15: 82,043,981 A14S probably benign Het
Snx27 A C 3: 94,531,234 D231E probably damaging Het
Spef2 A G 15: 9,725,197 I158T possibly damaging Het
Sptb A G 12: 76,649,869 I19T possibly damaging Het
Ssu72 T C 4: 155,733,513 L175P probably damaging Het
Tecr C T 8: 83,572,575 V248I probably benign Het
Tnfrsf13b T G 11: 61,141,476 S59A probably benign Het
Tom1l1 T C 11: 90,671,125 T150A possibly damaging Het
Ubr3 A T 2: 69,936,018 Y410F probably damaging Het
Vmn2r108 A G 17: 20,472,315 I93T probably damaging Het
Vmn2r19 A G 6: 123,329,978 T482A probably benign Het
Vstm4 T A 14: 32,863,707 M77K probably benign Het
Zbtb17 C T 4: 141,464,585 T309I probably damaging Het
Zfp957 T C 14: 79,214,054 T102A probably damaging Het
Other mutations in Gmeb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Gmeb2 APN 2 181259043 missense probably benign 0.18
IGL02882:Gmeb2 APN 2 181265883 missense probably damaging 0.98
R0437:Gmeb2 UTSW 2 181253973 missense possibly damaging 0.83
R1499:Gmeb2 UTSW 2 181255226 missense probably benign 0.01
R2064:Gmeb2 UTSW 2 181253970 missense probably benign 0.42
R2127:Gmeb2 UTSW 2 181259049 missense probably benign 0.21
R3087:Gmeb2 UTSW 2 181255640 splice site probably benign
R4202:Gmeb2 UTSW 2 181253973 missense possibly damaging 0.83
R4470:Gmeb2 UTSW 2 181265145 intron probably null
R4936:Gmeb2 UTSW 2 181254246 missense probably benign 0.04
R5296:Gmeb2 UTSW 2 181255986 intron probably benign
R5402:Gmeb2 UTSW 2 181255957 splice site probably null
R5708:Gmeb2 UTSW 2 181264989 missense probably damaging 1.00
R5934:Gmeb2 UTSW 2 181255574 missense possibly damaging 0.63
R7673:Gmeb2 UTSW 2 181260388 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACATGTGCTTCCAGGAAGGC -3'
(R):5'- TGGAACCAGTTGGCAAGTTTG -3'

Sequencing Primer
(F):5'- TGCTTCCAGGAAGGCTACAAAG -3'
(R):5'- CCCCTGCAGTTAGACAGTAGATG -3'
Posted On2014-12-04