Incidental Mutation 'R2517:Snx27'
ID253899
Institutional Source Beutler Lab
Gene Symbol Snx27
Ensembl Gene ENSMUSG00000028136
Gene Namesorting nexin family member 27
SynonymsESTM47, 5730552M22Rik
MMRRC Submission 040421-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2517 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location94497544-94582716 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 94531234 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 231 (D231E)
Ref Sequence ENSEMBL: ENSMUSP00000102904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029783] [ENSMUST00000107283] [ENSMUST00000198426] [ENSMUST00000199462] [ENSMUST00000200642]
Predicted Effect probably damaging
Transcript: ENSMUST00000029783
AA Change: D231E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029783
Gene: ENSMUSG00000028136
AA Change: D231E

DomainStartEndE-ValueType
low complexity region 18 38 N/A INTRINSIC
PDZ 49 134 3.77e-19 SMART
PX 154 263 7.5e-21 SMART
Pfam:RA 271 360 1.2e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107283
AA Change: D231E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102904
Gene: ENSMUSG00000028136
AA Change: D231E

DomainStartEndE-ValueType
low complexity region 18 38 N/A INTRINSIC
PDZ 49 134 3.77e-19 SMART
PX 154 263 7.5e-21 SMART
Pfam:RA 271 360 1.5e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000198426
AA Change: D61E

PolyPhen 2 Score 0.610 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000143525
Gene: ENSMUSG00000028136
AA Change: D61E

DomainStartEndE-ValueType
PX 1 93 5.11e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198902
Predicted Effect probably benign
Transcript: ENSMUST00000199462
SMART Domains Protein: ENSMUSP00000143378
Gene: ENSMUSG00000028136

DomainStartEndE-ValueType
low complexity region 18 38 N/A INTRINSIC
PDB:3QE1|A 39 58 9e-7 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000200642
AA Change: D140E

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143066
Gene: ENSMUSG00000028136
AA Change: D140E

DomainStartEndE-ValueType
PDB:3QGL|E 12 42 3e-12 PDB
PX 63 172 7.5e-21 SMART
Pfam:RA 180 269 5.3e-14 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family, a diverse group of cytoplasmic and membrane-associated proteins involved in endocytosis of plasma membrane receptors and protein trafficking through these compartments. All members of this protein family contain a phosphoinositide binding domain (PX domain). A highly similar protein in mouse is responsible for the specific recruitment of an isoform of serotonin 5-hydroxytryptamine 4 receptor into early endosomes, suggesting the analogous role for the human protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal and postnatal lethality, decreased organ size, slow postnatal weight gain, and decreased endocytosis of Grin2c. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700042G07Rik A G 4: 116,173,594 D65G probably benign Het
Adcy4 C A 14: 55,781,946 E82D probably damaging Het
AF067061 T A 13: 120,263,939 C46* probably null Het
Ago1 G A 4: 126,439,939 R486* probably null Het
Ago2 T A 15: 73,124,242 N346I possibly damaging Het
Apol11a A T 15: 77,517,195 D294V probably benign Het
Atp13a5 A G 16: 29,297,397 F634L possibly damaging Het
Atp2a2 G A 5: 122,457,513 P953L probably damaging Het
Brca2 A G 5: 150,539,672 D967G probably benign Het
Bud13 A T 9: 46,288,148 H269L probably benign Het
Cachd1 A T 4: 100,980,882 probably null Het
Cog3 T C 14: 75,741,742 D188G probably benign Het
Col15a1 T C 4: 47,208,492 S20P probably damaging Het
Col4a3 A G 1: 82,680,710 D838G unknown Het
Cwh43 A T 5: 73,421,543 T298S probably benign Het
Dip2c A G 13: 9,609,005 R847G probably damaging Het
Dnah2 C T 11: 69,516,644 D438N probably damaging Het
Drg2 T C 11: 60,468,128 V358A probably damaging Het
Eif4enif1 T A 11: 3,221,168 W220R probably damaging Het
Enpp2 A T 15: 54,919,694 I75K probably damaging Het
Fam110c T C 12: 31,075,239 I400T probably damaging Het
Fam193b C A 13: 55,542,816 R711L probably damaging Het
Fgfr1 T C 8: 25,563,446 Y246H probably damaging Het
Frs3 G A 17: 47,703,072 R230Q probably benign Het
Galnt5 A G 2: 57,999,413 K342E probably benign Het
Glrb A T 3: 80,861,747 L189Q probably damaging Het
Gmeb2 T C 2: 181,259,026 T193A probably benign Het
Gnl3 A G 14: 31,014,163 S307P probably damaging Het
Golim4 A T 3: 75,892,859 F443I probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Klf10 A C 15: 38,297,113 Y228D probably benign Het
Klrc3 A T 6: 129,639,557 W166R probably damaging Het
Kng2 A T 16: 22,988,315 I378N probably benign Het
Map3k10 T C 7: 27,663,263 K466R possibly damaging Het
Mrrf C T 2: 36,189,097 T245M probably benign Het
Msi1 A G 5: 115,445,458 Y239C probably damaging Het
Nfasc A G 1: 132,597,763 probably null Het
Olfr1375 T A 11: 51,048,473 L122Q probably damaging Het
Olfr843 A T 9: 19,249,061 C113S probably benign Het
Pkd1l1 T C 11: 8,958,900 E368G unknown Het
Polq G A 16: 37,089,325 G2078D probably damaging Het
Ppfibp1 A C 6: 146,992,444 I134L probably damaging Het
Rasip1 A T 7: 45,634,823 I608F probably damaging Het
Ripk3 A T 14: 55,788,035 V24E probably damaging Het
Rtkn T A 6: 83,147,545 I110N probably damaging Het
Scn1a C T 2: 66,273,832 V1695I probably damaging Het
Shank2 A G 7: 144,052,305 N75S possibly damaging Het
Snu13 C A 15: 82,043,981 A14S probably benign Het
Spef2 A G 15: 9,725,197 I158T possibly damaging Het
Sptb A G 12: 76,649,869 I19T possibly damaging Het
Ssu72 T C 4: 155,733,513 L175P probably damaging Het
Tecr C T 8: 83,572,575 V248I probably benign Het
Tnfrsf13b T G 11: 61,141,476 S59A probably benign Het
Tom1l1 T C 11: 90,671,125 T150A possibly damaging Het
Ubr3 A T 2: 69,936,018 Y410F probably damaging Het
Vmn2r108 A G 17: 20,472,315 I93T probably damaging Het
Vmn2r19 A G 6: 123,329,978 T482A probably benign Het
Vstm4 T A 14: 32,863,707 M77K probably benign Het
Zbtb17 C T 4: 141,464,585 T309I probably damaging Het
Zfp957 T C 14: 79,214,054 T102A probably damaging Het
Other mutations in Snx27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Snx27 APN 3 94561972 missense probably damaging 1.00
IGL01061:Snx27 APN 3 94528980 splice site probably benign
IGL01598:Snx27 APN 3 94561843 missense probably damaging 1.00
IGL02276:Snx27 APN 3 94531379 missense probably damaging 1.00
IGL02558:Snx27 APN 3 94502881 missense probably damaging 0.99
IGL02748:Snx27 APN 3 94503565 missense probably benign 0.04
IGL02817:Snx27 APN 3 94503463 missense probably damaging 1.00
IGL02965:Snx27 APN 3 94582426 missense probably damaging 0.99
R0733:Snx27 UTSW 3 94562013 missense probably benign 0.03
R1241:Snx27 UTSW 3 94520233 missense probably benign 0.18
R1882:Snx27 UTSW 3 94519109 missense probably damaging 0.97
R3850:Snx27 UTSW 3 94520235 missense probably benign 0.00
R3964:Snx27 UTSW 3 94531306 missense probably damaging 1.00
R4035:Snx27 UTSW 3 94524244 missense probably damaging 0.99
R4172:Snx27 UTSW 3 94503487 missense probably benign 0.00
R4424:Snx27 UTSW 3 94562023 missense probably benign 0.03
R4425:Snx27 UTSW 3 94562023 missense probably benign 0.03
R4548:Snx27 UTSW 3 94526439 intron probably benign
R4820:Snx27 UTSW 3 94520211 missense probably damaging 1.00
R5114:Snx27 UTSW 3 94524244 missense probably damaging 1.00
R5672:Snx27 UTSW 3 94502850 splice site probably null
R5877:Snx27 UTSW 3 94502963 missense probably damaging 1.00
R7138:Snx27 UTSW 3 94528940 missense probably benign 0.04
R7284:Snx27 UTSW 3 94524191 missense probably damaging 0.97
R7403:Snx27 UTSW 3 94528926 missense probably damaging 1.00
R7593:Snx27 UTSW 3 94502965 missense possibly damaging 0.83
R7827:Snx27 UTSW 3 94519059 missense probably benign 0.11
X0057:Snx27 UTSW 3 94524274 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- TTTGGGTAGGGCACAAACC -3'
(R):5'- TGCATAGAAATAGACCTAGCCACTATG -3'

Sequencing Primer
(F):5'- CCATCATTGCAAATAAACGGTGGTG -3'
(R):5'- ATGCACCTGGCTTTAGATGAC -3'
Posted On2014-12-04