Incidental Mutation 'R2872:Igsf9b'
ID253904
Institutional Source Beutler Lab
Gene Symbol Igsf9b
Ensembl Gene ENSMUSG00000034275
Gene Nameimmunoglobulin superfamily, member 9B
SynonymsLOC235086
MMRRC Submission 040460-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.821) question?
Stock #R2872 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location27299204-27357546 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27322223 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 340 (I340V)
Ref Sequence ENSEMBL: ENSMUSP00000149356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115247] [ENSMUST00000133213] [ENSMUST00000214357]
Predicted Effect probably benign
Transcript: ENSMUST00000115247
AA Change: I340V

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000110902
Gene: ENSMUSG00000034275
AA Change: I340V

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 30 134 9.41e-9 SMART
IGc2 152 215 1.82e-15 SMART
FN3 232 302 7.02e1 SMART
IGc2 241 310 3.01e-7 SMART
IG 331 417 2.79e-2 SMART
IGc2 433 495 5.48e-10 SMART
FN3 510 591 1.35e-7 SMART
FN3 615 695 3.08e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133213
AA Change: I340V

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000117017
Gene: ENSMUSG00000034275
AA Change: I340V

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 30 134 9.41e-9 SMART
IGc2 152 215 1.82e-15 SMART
FN3 232 302 7.02e1 SMART
IGc2 241 310 3.01e-7 SMART
IG 331 417 2.79e-2 SMART
IGc2 433 495 5.48e-10 SMART
FN3 510 591 1.35e-7 SMART
FN3 615 695 3.08e-2 SMART
transmembrane domain 727 749 N/A INTRINSIC
low complexity region 750 760 N/A INTRINSIC
low complexity region 835 843 N/A INTRINSIC
low complexity region 971 982 N/A INTRINSIC
low complexity region 990 1001 N/A INTRINSIC
low complexity region 1148 1161 N/A INTRINSIC
low complexity region 1172 1190 N/A INTRINSIC
low complexity region 1246 1273 N/A INTRINSIC
low complexity region 1284 1296 N/A INTRINSIC
low complexity region 1313 1326 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214187
Predicted Effect probably benign
Transcript: ENSMUST00000214357
AA Change: I340V

PolyPhen 2 Score 0.106 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.0897 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.6%
  • 10x: 94.5%
  • 20x: 80.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,955,176 C811R possibly damaging Het
AI481877 A C 4: 59,093,850 L226R probably damaging Het
Ak8 T C 2: 28,742,720 I317T possibly damaging Het
Als2 A G 1: 59,211,137 S483P probably damaging Het
Arhgef10 T C 8: 14,975,093 probably null Het
Arhgef10 A G 8: 14,975,666 I459V probably benign Het
Armc2 C T 10: 41,966,700 probably null Het
Atp12a A G 14: 56,386,950 R952G possibly damaging Het
Atp6v1g1 A G 4: 63,550,021 Y87C probably benign Het
Col12a1 A T 9: 79,699,549 F531I probably damaging Het
Csmd2 T C 4: 128,557,718 F113S unknown Het
Ctnnd1 C T 2: 84,620,888 V123I possibly damaging Het
Cyp4a14 C A 4: 115,487,301 G456W probably damaging Het
Cyp4a30b A G 4: 115,458,362 H260R possibly damaging Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Frmpd4 A T X: 167,477,247 D1166E probably benign Het
Gpr156 T A 16: 37,992,223 V307D probably damaging Het
Gpr35 G A 1: 92,983,126 V187I probably benign Het
Gria2 G A 3: 80,702,492 T670I probably damaging Het
Hdac10 G T 15: 89,125,856 Q300K possibly damaging Het
Hdhd2 T C 18: 76,955,006 F44L probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hmcn1 A T 1: 150,738,716 V1313D possibly damaging Het
Ick A T 9: 78,140,100 probably null Het
Ift172 C T 5: 31,257,861 V1335I probably benign Het
Kif1c A G 11: 70,724,081 E567G probably damaging Het
Klf8 A T X: 153,382,682 E82D probably damaging Het
Matr3 T A 18: 35,572,296 S91R probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mtor T A 4: 148,540,030 M2089K probably benign Het
Myo9b T C 8: 71,290,966 Y224H probably benign Het
Nlrc3 T C 16: 3,957,326 D774G possibly damaging Het
Notum A G 11: 120,660,196 V48A probably benign Het
Nox3 T C 17: 3,682,916 H240R probably damaging Het
Nsun2 A G 13: 69,629,682 T425A probably damaging Het
Olfr1510 T G 14: 52,410,861 T4P probably benign Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Olfr654 T C 7: 104,588,493 S230P possibly damaging Het
Olfr99 A G 17: 37,279,976 V148A possibly damaging Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Otud4 T A 8: 79,661,073 N300K possibly damaging Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Paqr5 A T 9: 61,968,779 probably null Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Pcdhga9 T A 18: 37,737,471 Y118N possibly damaging Het
Pkd1l2 C T 8: 117,038,164 V1332I probably benign Het
Plcl1 A T 1: 55,697,150 D550V probably benign Het
Plekhg1 T G 10: 3,963,982 S1235A probably benign Het
Plekhg5 T A 4: 152,107,503 C433S probably benign Het
Plin2 A G 4: 86,668,678 M1T probably null Het
Polg2 A G 11: 106,775,425 probably null Het
Ppp1r7 T A 1: 93,357,863 probably null Het
Prdx4 A G X: 155,340,464 V15A probably benign Het
Rapgef6 T A 11: 54,661,175 F956L probably damaging Het
Rasl12 A G 9: 65,408,323 N83S probably benign Het
Rel T C 11: 23,761,129 I13V probably benign Het
Reln C T 5: 22,049,791 V527I possibly damaging Het
Sel1l3 C T 5: 53,137,883 W792* probably null Het
Slc39a8 T A 3: 135,886,793 probably null Het
Slc6a9 T A 4: 117,849,381 M1K probably null Het
Smpdl3a T A 10: 57,802,530 F143Y possibly damaging Het
Spsb4 G T 9: 96,996,018 T84K probably damaging Het
Tbc1d8 A G 1: 39,405,317 F187S probably damaging Het
Tdpoz3 T A 3: 93,826,428 F137I probably benign Het
Tgm7 G A 2: 121,109,693 probably benign Het
Tnni3k C T 3: 154,938,750 probably null Het
Tpd52 A T 3: 9,003,406 Y16* probably null Het
Trpa1 A G 1: 14,887,620 C705R probably damaging Het
Ttn A G 2: 76,750,851 S23233P probably damaging Het
Uevld T C 7: 46,947,945 D154G probably null Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Zfp292 G A 4: 34,808,595 T1483M probably damaging Het
Other mutations in Igsf9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Igsf9b APN 9 27319655 missense probably damaging 1.00
IGL01013:Igsf9b APN 9 27334304 missense probably damaging 1.00
IGL01960:Igsf9b APN 9 27328606 missense possibly damaging 0.93
IGL02398:Igsf9b APN 9 27333130 missense possibly damaging 0.54
IGL03007:Igsf9b APN 9 27333082 missense probably damaging 0.98
IGL03014:Igsf9b UTSW 9 27322636 missense probably benign 0.00
R0127:Igsf9b UTSW 9 27334385 missense possibly damaging 0.65
R0376:Igsf9b UTSW 9 27334582 missense probably benign 0.01
R0520:Igsf9b UTSW 9 27323250 missense probably benign 0.00
R0534:Igsf9b UTSW 9 27333062 intron probably null
R0613:Igsf9b UTSW 9 27326920 missense probably damaging 1.00
R0718:Igsf9b UTSW 9 27323361 critical splice donor site probably null
R0828:Igsf9b UTSW 9 27319605 nonsense probably null
R0879:Igsf9b UTSW 9 27333742 missense probably damaging 1.00
R0882:Igsf9b UTSW 9 27319316 missense probably damaging 0.98
R0987:Igsf9b UTSW 9 27332553 splice site probably null
R1162:Igsf9b UTSW 9 27326889 missense probably benign
R1758:Igsf9b UTSW 9 27334252 missense possibly damaging 0.50
R1760:Igsf9b UTSW 9 27317827 missense possibly damaging 0.82
R1819:Igsf9b UTSW 9 27311593 missense probably damaging 0.98
R1823:Igsf9b UTSW 9 27331732 missense probably damaging 0.96
R1982:Igsf9b UTSW 9 27322239 missense possibly damaging 0.82
R2150:Igsf9b UTSW 9 27334337 missense probably damaging 1.00
R2228:Igsf9b UTSW 9 27333496 missense probably damaging 1.00
R2229:Igsf9b UTSW 9 27333496 missense probably damaging 1.00
R2250:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R2872:Igsf9b UTSW 9 27322223 missense probably benign 0.11
R3415:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R3416:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R3417:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R3427:Igsf9b UTSW 9 27334577 missense probably damaging 0.99
R4356:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R4357:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R4358:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R4359:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R4379:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R4416:Igsf9b UTSW 9 27322917 missense probably damaging 1.00
R4445:Igsf9b UTSW 9 27334252 missense probably benign 0.13
R4446:Igsf9b UTSW 9 27334252 missense probably benign 0.13
R4787:Igsf9b UTSW 9 27317456 missense probably benign 0.26
R4887:Igsf9b UTSW 9 27322650 missense probably benign 0.45
R5085:Igsf9b UTSW 9 27317437 missense probably benign 0.03
R5360:Igsf9b UTSW 9 27311672 missense probably damaging 0.98
R5417:Igsf9b UTSW 9 27334276 small insertion probably benign
R5686:Igsf9b UTSW 9 27324179 missense probably damaging 0.99
R5738:Igsf9b UTSW 9 27328530 missense probably damaging 0.98
R5869:Igsf9b UTSW 9 27323235 missense probably benign 0.44
R6304:Igsf9b UTSW 9 27342575 missense probably benign 0.19
R6359:Igsf9b UTSW 9 27309599 missense probably benign 0.25
R6367:Igsf9b UTSW 9 27309525 nonsense probably null
R6556:Igsf9b UTSW 9 27329555 missense probably damaging 1.00
R7058:Igsf9b UTSW 9 27322854 missense probably damaging 0.99
R7165:Igsf9b UTSW 9 27334240 missense probably benign
R7180:Igsf9b UTSW 9 27322668 missense possibly damaging 0.95
R7212:Igsf9b UTSW 9 27331696 missense probably damaging 0.98
R7461:Igsf9b UTSW 9 27334122 missense probably benign 0.10
R7605:Igsf9b UTSW 9 27323312 missense probably damaging 0.98
R7609:Igsf9b UTSW 9 27345890 missense probably benign
R7613:Igsf9b UTSW 9 27334122 missense probably benign 0.10
X0013:Igsf9b UTSW 9 27331725 missense possibly damaging 0.89
X0025:Igsf9b UTSW 9 27309461 missense probably damaging 1.00
X0028:Igsf9b UTSW 9 27334372 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAGAATCTTAGCTAGGAGGTGG -3'
(R):5'- TGCCAGATCGTTGCTCTTTG -3'

Sequencing Primer
(F):5'- ATCTTAGCTAGGAGGTGGAAAGGTTC -3'
(R):5'- CAGATCGTTGCTCTTTGTTTGCCTAG -3'
Posted On2014-12-04