Incidental Mutation 'R2517:Ago1'
ID 253905
Institutional Source Beutler Lab
Gene Symbol Ago1
Ensembl Gene ENSMUSG00000041530
Gene Name argonaute RISC catalytic subunit 1
Synonyms Eif2c1, argonaute 1
MMRRC Submission 040421-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.789) question?
Stock # R2517 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 126328805-126362376 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 126333732 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 486 (R486*)
Ref Sequence ENSEMBL: ENSMUSP00000134871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097888] [ENSMUST00000176315]
AlphaFold Q8CJG1
Predicted Effect probably null
Transcript: ENSMUST00000097888
AA Change: R790*
SMART Domains Protein: ENSMUSP00000095498
Gene: ENSMUSG00000041530
AA Change: R790*

DomainStartEndE-ValueType
Pfam:ArgoN 26 164 2.3e-26 PFAM
DUF1785 173 225 3.48e-25 SMART
PAZ 233 368 1.41e-5 SMART
Pfam:ArgoL2 373 418 3.6e-18 PFAM
Pfam:ArgoMid 427 509 7.6e-37 PFAM
Piwi 515 816 4.16e-131 SMART
Blast:Piwi 823 849 3e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000127800
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156533
Predicted Effect probably null
Transcript: ENSMUST00000176315
AA Change: R486*
SMART Domains Protein: ENSMUSP00000134871
Gene: ENSMUSG00000041530
AA Change: R486*

DomainStartEndE-ValueType
Pfam:PAZ 1 62 4.1e-23 PFAM
Piwi 211 512 4.16e-131 SMART
Blast:Piwi 519 545 2e-6 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the argonaute family of proteins, which associate with small RNAs and have important roles in RNA interference (RNAi) and RNA silencing. This protein binds to microRNAs (miRNAs) or small interfering RNAs (siRNAs) and represses translation of mRNAs that are complementary to them. It is also involved in transcriptional gene silencing (TGS) of promoter regions that are complementary to bound short antigene RNAs (agRNAs), as well as in the degradation of miRNA-bound mRNA targets. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A recent study showed this gene to be an authentic stop codon readthrough target, and that its mRNA could give rise to an additional C-terminally extended isoform by use of an alternative in-frame translation termination codon. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a conditional allele activated in keratinocytes exhibit no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 C A 14: 56,019,403 (GRCm39) E82D probably damaging Het
Ago2 T A 15: 72,996,091 (GRCm39) N346I possibly damaging Het
Apol11a A T 15: 77,401,395 (GRCm39) D294V probably benign Het
Atp13a5 A G 16: 29,116,215 (GRCm39) F634L possibly damaging Het
Atp2a2 G A 5: 122,595,576 (GRCm39) P953L probably damaging Het
Brca2 A G 5: 150,463,137 (GRCm39) D967G probably benign Het
Bud13 A T 9: 46,199,446 (GRCm39) H269L probably benign Het
Cachd1 A T 4: 100,838,079 (GRCm39) probably null Het
Cog3 T C 14: 75,979,182 (GRCm39) D188G probably benign Het
Col15a1 T C 4: 47,208,492 (GRCm39) S20P probably damaging Het
Col4a3 A G 1: 82,658,431 (GRCm39) D838G unknown Het
Cwh43 A T 5: 73,578,886 (GRCm39) T298S probably benign Het
Dip2c A G 13: 9,659,041 (GRCm39) R847G probably damaging Het
Dnah2 C T 11: 69,407,470 (GRCm39) D438N probably damaging Het
Drg2 T C 11: 60,358,954 (GRCm39) V358A probably damaging Het
Eif4enif1 T A 11: 3,171,168 (GRCm39) W220R probably damaging Het
Enpp2 A T 15: 54,783,090 (GRCm39) I75K probably damaging Het
Fam110c T C 12: 31,125,238 (GRCm39) I400T probably damaging Het
Fam193b C A 13: 55,690,629 (GRCm39) R711L probably damaging Het
Fgfr1 T C 8: 26,053,462 (GRCm39) Y246H probably damaging Het
Frs3 G A 17: 48,013,997 (GRCm39) R230Q probably benign Het
Galnt5 A G 2: 57,889,425 (GRCm39) K342E probably benign Het
Glrb A T 3: 80,769,054 (GRCm39) L189Q probably damaging Het
Gmeb2 T C 2: 180,900,819 (GRCm39) T193A probably benign Het
Gnl3 A G 14: 30,736,120 (GRCm39) S307P probably damaging Het
Golim4 A T 3: 75,800,166 (GRCm39) F443I probably benign Het
Hivep2 C A 10: 14,004,713 (GRCm39) T437K probably benign Het
Klf10 A C 15: 38,297,357 (GRCm39) Y228D probably benign Het
Klrc3 A T 6: 129,616,520 (GRCm39) W166R probably damaging Het
Kng2 A T 16: 22,807,065 (GRCm39) I378N probably benign Het
Map3k10 T C 7: 27,362,688 (GRCm39) K466R possibly damaging Het
Mrrf C T 2: 36,079,109 (GRCm39) T245M probably benign Het
Msi1 A G 5: 115,583,517 (GRCm39) Y239C probably damaging Het
Nfasc A G 1: 132,525,501 (GRCm39) probably null Het
Or1x6 T A 11: 50,939,300 (GRCm39) L122Q probably damaging Het
Or7g25 A T 9: 19,160,357 (GRCm39) C113S probably benign Het
P3r3urf A G 4: 116,030,791 (GRCm39) D65G probably benign Het
Pkd1l1 T C 11: 8,908,900 (GRCm39) E368G unknown Het
Polq G A 16: 36,909,687 (GRCm39) G2078D probably damaging Het
Ppfibp1 A C 6: 146,893,942 (GRCm39) I134L probably damaging Het
Rasip1 A T 7: 45,284,247 (GRCm39) I608F probably damaging Het
Ripk3 A T 14: 56,025,492 (GRCm39) V24E probably damaging Het
Rtkn T A 6: 83,124,526 (GRCm39) I110N probably damaging Het
Scn1a C T 2: 66,104,176 (GRCm39) V1695I probably damaging Het
Shank2 A G 7: 143,606,042 (GRCm39) N75S possibly damaging Het
Snu13 C A 15: 81,928,182 (GRCm39) A14S probably benign Het
Snx27 A C 3: 94,438,541 (GRCm39) D231E probably damaging Het
Spef2 A G 15: 9,725,283 (GRCm39) I158T possibly damaging Het
Sptb A G 12: 76,696,643 (GRCm39) I19T possibly damaging Het
Ssu72 T C 4: 155,817,970 (GRCm39) L175P probably damaging Het
Tcstv2a T A 13: 120,725,475 (GRCm39) C46* probably null Het
Tecr C T 8: 84,299,204 (GRCm39) V248I probably benign Het
Tnfrsf13b T G 11: 61,032,302 (GRCm39) S59A probably benign Het
Tom1l1 T C 11: 90,561,951 (GRCm39) T150A possibly damaging Het
Ubr3 A T 2: 69,766,362 (GRCm39) Y410F probably damaging Het
Vmn2r108 A G 17: 20,692,577 (GRCm39) I93T probably damaging Het
Vmn2r19 A G 6: 123,306,937 (GRCm39) T482A probably benign Het
Vstm4 T A 14: 32,585,664 (GRCm39) M77K probably benign Het
Zbtb17 C T 4: 141,191,896 (GRCm39) T309I probably damaging Het
Zfp957 T C 14: 79,451,494 (GRCm39) T102A probably damaging Het
Other mutations in Ago1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01377:Ago1 APN 4 126,353,610 (GRCm39) missense probably damaging 0.98
IGL02578:Ago1 APN 4 126,333,324 (GRCm39) missense probably benign 0.12
IGL02709:Ago1 APN 4 126,347,433 (GRCm39) nonsense probably null
IGL02810:Ago1 APN 4 126,336,886 (GRCm39) missense probably benign 0.00
IGL03037:Ago1 APN 4 126,355,587 (GRCm39) missense probably benign 0.00
IGL03091:Ago1 APN 4 126,352,982 (GRCm39) missense probably damaging 0.98
IGL03100:Ago1 APN 4 126,336,964 (GRCm39) missense probably benign 0.08
IGL03121:Ago1 APN 4 126,353,796 (GRCm39) missense probably benign 0.00
R0195:Ago1 UTSW 4 126,357,484 (GRCm39) missense probably benign 0.01
R0244:Ago1 UTSW 4 126,357,499 (GRCm39) missense possibly damaging 0.94
R0309:Ago1 UTSW 4 126,336,959 (GRCm39) missense probably benign 0.06
R0514:Ago1 UTSW 4 126,333,388 (GRCm39) missense probably benign
R0557:Ago1 UTSW 4 126,353,817 (GRCm39) missense probably benign 0.00
R1104:Ago1 UTSW 4 126,347,426 (GRCm39) missense probably damaging 0.99
R1553:Ago1 UTSW 4 126,334,194 (GRCm39) missense probably damaging 0.99
R1624:Ago1 UTSW 4 126,357,534 (GRCm39) missense probably damaging 0.97
R1851:Ago1 UTSW 4 126,333,788 (GRCm39) missense probably benign 0.00
R1867:Ago1 UTSW 4 126,335,029 (GRCm39) missense probably damaging 0.98
R2001:Ago1 UTSW 4 126,348,187 (GRCm39) missense probably null 0.36
R2051:Ago1 UTSW 4 126,354,246 (GRCm39) missense probably benign 0.01
R2057:Ago1 UTSW 4 126,337,021 (GRCm39) missense probably damaging 0.98
R2105:Ago1 UTSW 4 126,355,581 (GRCm39) missense probably benign 0.30
R2117:Ago1 UTSW 4 126,357,650 (GRCm39) splice site probably null
R2256:Ago1 UTSW 4 126,335,704 (GRCm39) missense possibly damaging 0.80
R2272:Ago1 UTSW 4 126,347,443 (GRCm39) missense probably benign 0.01
R2850:Ago1 UTSW 4 126,336,868 (GRCm39) splice site probably benign
R2993:Ago1 UTSW 4 126,333,839 (GRCm39) splice site probably benign
R3746:Ago1 UTSW 4 126,354,837 (GRCm39) missense probably benign
R3747:Ago1 UTSW 4 126,354,837 (GRCm39) missense probably benign
R3750:Ago1 UTSW 4 126,354,837 (GRCm39) missense probably benign
R4600:Ago1 UTSW 4 126,354,185 (GRCm39) missense probably benign 0.37
R4934:Ago1 UTSW 4 126,342,652 (GRCm39) missense possibly damaging 0.56
R4983:Ago1 UTSW 4 126,347,447 (GRCm39) missense probably damaging 0.99
R5086:Ago1 UTSW 4 126,347,397 (GRCm39) missense probably benign 0.01
R5132:Ago1 UTSW 4 126,355,516 (GRCm39) missense probably benign 0.01
R5239:Ago1 UTSW 4 126,335,008 (GRCm39) missense probably damaging 1.00
R5609:Ago1 UTSW 4 126,354,830 (GRCm39) missense possibly damaging 0.80
R5705:Ago1 UTSW 4 126,342,587 (GRCm39) missense probably benign 0.01
R5980:Ago1 UTSW 4 126,354,362 (GRCm39) unclassified probably benign
R6036:Ago1 UTSW 4 126,337,021 (GRCm39) missense probably damaging 0.98
R6036:Ago1 UTSW 4 126,337,021 (GRCm39) missense probably damaging 0.98
R6398:Ago1 UTSW 4 126,342,601 (GRCm39) missense probably benign 0.26
R6505:Ago1 UTSW 4 126,357,628 (GRCm39) missense probably benign 0.00
R6545:Ago1 UTSW 4 126,348,145 (GRCm39) missense possibly damaging 0.74
R6944:Ago1 UTSW 4 126,354,215 (GRCm39) missense possibly damaging 0.78
R7041:Ago1 UTSW 4 126,357,499 (GRCm39) missense possibly damaging 0.94
R7490:Ago1 UTSW 4 126,333,298 (GRCm39) makesense probably null
R7496:Ago1 UTSW 4 126,355,545 (GRCm39) missense probably benign 0.20
R7575:Ago1 UTSW 4 126,347,701 (GRCm39) missense probably benign 0.12
R7625:Ago1 UTSW 4 126,337,022 (GRCm39) missense probably benign 0.18
R7988:Ago1 UTSW 4 126,354,210 (GRCm39) missense probably damaging 1.00
R8041:Ago1 UTSW 4 126,335,729 (GRCm39) missense probably damaging 1.00
R8073:Ago1 UTSW 4 126,337,019 (GRCm39) missense probably benign 0.04
R8086:Ago1 UTSW 4 126,354,774 (GRCm39) missense probably benign
R8127:Ago1 UTSW 4 126,348,214 (GRCm39) missense possibly damaging 0.95
R8772:Ago1 UTSW 4 126,354,316 (GRCm39) unclassified probably benign
R8878:Ago1 UTSW 4 126,357,516 (GRCm39) missense probably benign 0.35
R8989:Ago1 UTSW 4 126,357,583 (GRCm39) missense probably benign 0.01
R9140:Ago1 UTSW 4 126,336,977 (GRCm39) missense probably benign
X0025:Ago1 UTSW 4 126,336,908 (GRCm39) missense possibly damaging 0.47
Z1177:Ago1 UTSW 4 126,347,449 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAGGGTCTCAAATTGGATAGC -3'
(R):5'- GGGTATGGTCATGCAACCTAAAC -3'

Sequencing Primer
(F):5'- GATAGCATCCACTTCCTTCTATCAAC -3'
(R):5'- TGGTCATGCAACCTAAACATATTC -3'
Posted On 2014-12-04