Mutagenetix > Incidental Mutation

Incidental Mutation 'R2517:Ago1'

253905

Institutional Source

Beutler Lab

Gene Symbol

Ago1

Ensembl Gene

ENSMUSG00000041530

Gene Name

argonaute RISC catalytic subunit 1

Synonyms

Eif2c1, argonaute 1

MMRRC Submission

040421-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.811) question?

Stock #

R2517 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

126435012-126468583 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 126439939 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 486 (R486*)

Ref Sequence

ENSEMBL: ENSMUSP00000134871 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097888] [ENSMUST00000176315]

AlphaFold

Q8CJG1

Predicted Effect

probably null
Transcript: ENSMUST00000097888
AA Change: R790*

SMART Domains

Protein: ENSMUSP00000095498
Gene: ENSMUSG00000041530
AA Change: R790*

Domain	Start	End	E-Value	Type
Pfam:ArgoN	26	164	2.3e-26	PFAM
DUF1785	173	225	3.48e-25	SMART
PAZ	233	368	1.41e-5	SMART
Pfam:ArgoL2	373	418	3.6e-18	PFAM
Pfam:ArgoMid	427	509	7.6e-37	PFAM
Piwi	515	816	4.16e-131	SMART
Blast:Piwi	823	849	3e-6	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000127800

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156533

Predicted Effect

probably null
Transcript: ENSMUST00000176315
AA Change: R486*

SMART Domains

Protein: ENSMUSP00000134871
Gene: ENSMUSG00000041530
AA Change: R486*

Domain	Start	End	E-Value	Type
Pfam:PAZ	1	62	4.1e-23	PFAM
Piwi	211	512	4.16e-131	SMART
Blast:Piwi	519	545	2e-6	BLAST

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the argonaute family of proteins, which associate with small RNAs and have important roles in RNA interference (RNAi) and RNA silencing. This protein binds to microRNAs (miRNAs) or small interfering RNAs (siRNAs) and represses translation of mRNAs that are complementary to them. It is also involved in transcriptional gene silencing (TGS) of promoter regions that are complementary to bound short antigene RNAs (agRNAs), as well as in the degradation of miRNA-bound mRNA targets. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A recent study showed this gene to be an authentic stop codon readthrough target, and that its mRNA could give rise to an additional C-terminally extended isoform by use of an alternative in-frame translation termination codon. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a conditional allele activated in keratinocytes exhibit no abnormal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700042G07Rik	A	G	4: 116,173,594	D65G	probably benign	Het
Adcy4	C	A	14: 55,781,946	E82D	probably damaging	Het
AF067061	T	A	13: 120,263,939	C46*	probably null	Het
Ago2	T	A	15: 73,124,242	N346I	possibly damaging	Het
Apol11a	A	T	15: 77,517,195	D294V	probably benign	Het
Atp13a5	A	G	16: 29,297,397	F634L	possibly damaging	Het
Atp2a2	G	A	5: 122,457,513	P953L	probably damaging	Het
Brca2	A	G	5: 150,539,672	D967G	probably benign	Het
Bud13	A	T	9: 46,288,148	H269L	probably benign	Het
Cachd1	A	T	4: 100,980,882		probably null	Het
Cog3	T	C	14: 75,741,742	D188G	probably benign	Het
Col15a1	T	C	4: 47,208,492	S20P	probably damaging	Het
Col4a3	A	G	1: 82,680,710	D838G	unknown	Het
Cwh43	A	T	5: 73,421,543	T298S	probably benign	Het
Dip2c	A	G	13: 9,609,005	R847G	probably damaging	Het
Dnah2	C	T	11: 69,516,644	D438N	probably damaging	Het
Drg2	T	C	11: 60,468,128	V358A	probably damaging	Het
Eif4enif1	T	A	11: 3,221,168	W220R	probably damaging	Het
Enpp2	A	T	15: 54,919,694	I75K	probably damaging	Het
Fam110c	T	C	12: 31,075,239	I400T	probably damaging	Het
Fam193b	C	A	13: 55,542,816	R711L	probably damaging	Het
Fgfr1	T	C	8: 25,563,446	Y246H	probably damaging	Het
Frs3	G	A	17: 47,703,072	R230Q	probably benign	Het
Galnt5	A	G	2: 57,999,413	K342E	probably benign	Het
Glrb	A	T	3: 80,861,747	L189Q	probably damaging	Het
Gmeb2	T	C	2: 181,259,026	T193A	probably benign	Het
Gnl3	A	G	14: 31,014,163	S307P	probably damaging	Het
Golim4	A	T	3: 75,892,859	F443I	probably benign	Het
Hivep2	C	A	10: 14,128,969	T437K	probably benign	Het
Klf10	A	C	15: 38,297,113	Y228D	probably benign	Het
Klrc3	A	T	6: 129,639,557	W166R	probably damaging	Het
Kng2	A	T	16: 22,988,315	I378N	probably benign	Het
Map3k10	T	C	7: 27,663,263	K466R	possibly damaging	Het
Mrrf	C	T	2: 36,189,097	T245M	probably benign	Het
Msi1	A	G	5: 115,445,458	Y239C	probably damaging	Het
Nfasc	A	G	1: 132,597,763		probably null	Het
Olfr1375	T	A	11: 51,048,473	L122Q	probably damaging	Het
Olfr843	A	T	9: 19,249,061	C113S	probably benign	Het
Pkd1l1	T	C	11: 8,958,900	E368G	unknown	Het
Polq	G	A	16: 37,089,325	G2078D	probably damaging	Het
Ppfibp1	A	C	6: 146,992,444	I134L	probably damaging	Het
Rasip1	A	T	7: 45,634,823	I608F	probably damaging	Het
Ripk3	A	T	14: 55,788,035	V24E	probably damaging	Het
Rtkn	T	A	6: 83,147,545	I110N	probably damaging	Het
Scn1a	C	T	2: 66,273,832	V1695I	probably damaging	Het
Shank2	A	G	7: 144,052,305	N75S	possibly damaging	Het
Snu13	C	A	15: 82,043,981	A14S	probably benign	Het
Snx27	A	C	3: 94,531,234	D231E	probably damaging	Het
Spef2	A	G	15: 9,725,197	I158T	possibly damaging	Het
Sptb	A	G	12: 76,649,869	I19T	possibly damaging	Het
Ssu72	T	C	4: 155,733,513	L175P	probably damaging	Het
Tecr	C	T	8: 83,572,575	V248I	probably benign	Het
Tnfrsf13b	T	G	11: 61,141,476	S59A	probably benign	Het
Tom1l1	T	C	11: 90,671,125	T150A	possibly damaging	Het
Ubr3	A	T	2: 69,936,018	Y410F	probably damaging	Het
Vmn2r108	A	G	17: 20,472,315	I93T	probably damaging	Het
Vmn2r19	A	G	6: 123,329,978	T482A	probably benign	Het
Vstm4	T	A	14: 32,863,707	M77K	probably benign	Het
Zbtb17	C	T	4: 141,464,585	T309I	probably damaging	Het
Zfp957	T	C	14: 79,214,054	T102A	probably damaging	Het

Other mutations in Ago1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01377:Ago1	APN	4	126459817	missense	probably damaging	0.98
IGL02578:Ago1	APN	4	126439531	missense	probably benign	0.12
IGL02709:Ago1	APN	4	126453640	nonsense	probably null
IGL02810:Ago1	APN	4	126443093	missense	probably benign	0.00
IGL03037:Ago1	APN	4	126461794	missense	probably benign	0.00
IGL03091:Ago1	APN	4	126459189	missense	probably damaging	0.98
IGL03100:Ago1	APN	4	126443171	missense	probably benign	0.08
IGL03121:Ago1	APN	4	126460003	missense	probably benign	0.00
R0195:Ago1	UTSW	4	126463691	missense	probably benign	0.01
R0244:Ago1	UTSW	4	126463706	missense	possibly damaging	0.94
R0309:Ago1	UTSW	4	126443166	missense	probably benign	0.06
R0514:Ago1	UTSW	4	126439595	missense	probably benign
R0557:Ago1	UTSW	4	126460024	missense	probably benign	0.00
R1104:Ago1	UTSW	4	126453633	missense	probably damaging	0.99
R1553:Ago1	UTSW	4	126440401	missense	probably damaging	0.99
R1624:Ago1	UTSW	4	126463741	missense	probably damaging	0.97
R1851:Ago1	UTSW	4	126439995	missense	probably benign	0.00
R1867:Ago1	UTSW	4	126441236	missense	probably damaging	0.98
R2001:Ago1	UTSW	4	126454394	missense	probably null	0.36
R2051:Ago1	UTSW	4	126460453	missense	probably benign	0.01
R2057:Ago1	UTSW	4	126443228	missense	probably damaging	0.98
R2105:Ago1	UTSW	4	126461788	missense	probably benign	0.30
R2117:Ago1	UTSW	4	126463857	splice site	probably null
R2256:Ago1	UTSW	4	126441911	missense	possibly damaging	0.80
R2272:Ago1	UTSW	4	126453650	missense	probably benign	0.01
R2850:Ago1	UTSW	4	126443075	splice site	probably benign
R2993:Ago1	UTSW	4	126440046	splice site	probably benign
R3746:Ago1	UTSW	4	126461044	missense	probably benign
R3747:Ago1	UTSW	4	126461044	missense	probably benign
R3750:Ago1	UTSW	4	126461044	missense	probably benign
R4600:Ago1	UTSW	4	126460392	missense	probably benign	0.37
R4934:Ago1	UTSW	4	126448859	missense	possibly damaging	0.56
R4983:Ago1	UTSW	4	126453654	missense	probably damaging	0.99
R5086:Ago1	UTSW	4	126453604	missense	probably benign	0.01
R5132:Ago1	UTSW	4	126461723	missense	probably benign	0.01
R5239:Ago1	UTSW	4	126441215	missense	probably damaging	1.00
R5609:Ago1	UTSW	4	126461037	missense	possibly damaging	0.80
R5705:Ago1	UTSW	4	126448794	missense	probably benign	0.01
R5980:Ago1	UTSW	4	126460569	unclassified	probably benign
R6036:Ago1	UTSW	4	126443228	missense	probably damaging	0.98
R6036:Ago1	UTSW	4	126443228	missense	probably damaging	0.98
R6398:Ago1	UTSW	4	126448808	missense	probably benign	0.26
R6505:Ago1	UTSW	4	126463835	missense	probably benign	0.00
R6545:Ago1	UTSW	4	126454352	missense	possibly damaging	0.74
R6944:Ago1	UTSW	4	126460422	missense	possibly damaging	0.78
R7041:Ago1	UTSW	4	126463706	missense	possibly damaging	0.94
R7490:Ago1	UTSW	4	126439505	makesense	probably null
R7496:Ago1	UTSW	4	126461752	missense	probably benign	0.20
R7575:Ago1	UTSW	4	126453908	missense	probably benign	0.12
R7625:Ago1	UTSW	4	126443229	missense	probably benign	0.18
R7988:Ago1	UTSW	4	126460417	missense	probably damaging	1.00
R8041:Ago1	UTSW	4	126441936	missense	probably damaging	1.00
R8073:Ago1	UTSW	4	126443226	missense	probably benign	0.04
R8086:Ago1	UTSW	4	126460981	missense	probably benign
R8127:Ago1	UTSW	4	126454421	missense	possibly damaging	0.95
R8772:Ago1	UTSW	4	126460523	unclassified	probably benign
R8878:Ago1	UTSW	4	126463723	missense	probably benign	0.35
R8989:Ago1	UTSW	4	126463790	missense	probably benign	0.01
R9140:Ago1	UTSW	4	126443184	missense	probably benign
X0025:Ago1	UTSW	4	126443115	missense	possibly damaging	0.47
Z1177:Ago1	UTSW	4	126453656	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCAAGGGTCTCAAATTGGATAGC -3'
(R):5'- GGGTATGGTCATGCAACCTAAAC -3'

Sequencing Primer
(F):5'- GATAGCATCCACTTCCTTCTATCAAC -3'
(R):5'- TGGTCATGCAACCTAAACATATTC -3'

Posted On

2014-12-04