Incidental Mutation 'R2517:Ssu72'
ID253909
Institutional Source Beutler Lab
Gene Symbol Ssu72
Ensembl Gene ENSMUSG00000029038
Gene NameSsu72 RNA polymerase II CTD phosphatase homolog (yeast)
Synonyms
MMRRC Submission 040421-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R2517 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location155704800-155733879 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 155733513 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 175 (L175P)
Ref Sequence ENSEMBL: ENSMUSP00000030905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030905] [ENSMUST00000105595] [ENSMUST00000127188] [ENSMUST00000147721]
Predicted Effect probably damaging
Transcript: ENSMUST00000030905
AA Change: L175P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030905
Gene: ENSMUSG00000029038
AA Change: L175P

DomainStartEndE-ValueType
Pfam:Ssu72 6 194 1.3e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105595
SMART Domains Protein: ENSMUSP00000101220
Gene: ENSMUSG00000029038

DomainStartEndE-ValueType
Pfam:Ssu72 4 176 2.8e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127188
SMART Domains Protein: ENSMUSP00000127341
Gene: ENSMUSG00000084845

DomainStartEndE-ValueType
Pfam:TMEM240 1 173 3.8e-108 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147721
SMART Domains Protein: ENSMUSP00000130974
Gene: ENSMUSG00000084845

DomainStartEndE-ValueType
Pfam:TMEM240 1 173 1.5e-100 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176526
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178987
SMART Domains Protein: ENSMUSP00000136958
Gene: ENSMUSG00000096221

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 41 52 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197451
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700042G07Rik A G 4: 116,173,594 D65G probably benign Het
Adcy4 C A 14: 55,781,946 E82D probably damaging Het
AF067061 T A 13: 120,263,939 C46* probably null Het
Ago1 G A 4: 126,439,939 R486* probably null Het
Ago2 T A 15: 73,124,242 N346I possibly damaging Het
Apol11a A T 15: 77,517,195 D294V probably benign Het
Atp13a5 A G 16: 29,297,397 F634L possibly damaging Het
Atp2a2 G A 5: 122,457,513 P953L probably damaging Het
Brca2 A G 5: 150,539,672 D967G probably benign Het
Bud13 A T 9: 46,288,148 H269L probably benign Het
Cachd1 A T 4: 100,980,882 probably null Het
Cog3 T C 14: 75,741,742 D188G probably benign Het
Col15a1 T C 4: 47,208,492 S20P probably damaging Het
Col4a3 A G 1: 82,680,710 D838G unknown Het
Cwh43 A T 5: 73,421,543 T298S probably benign Het
Dip2c A G 13: 9,609,005 R847G probably damaging Het
Dnah2 C T 11: 69,516,644 D438N probably damaging Het
Drg2 T C 11: 60,468,128 V358A probably damaging Het
Eif4enif1 T A 11: 3,221,168 W220R probably damaging Het
Enpp2 A T 15: 54,919,694 I75K probably damaging Het
Fam110c T C 12: 31,075,239 I400T probably damaging Het
Fam193b C A 13: 55,542,816 R711L probably damaging Het
Fgfr1 T C 8: 25,563,446 Y246H probably damaging Het
Frs3 G A 17: 47,703,072 R230Q probably benign Het
Galnt5 A G 2: 57,999,413 K342E probably benign Het
Glrb A T 3: 80,861,747 L189Q probably damaging Het
Gmeb2 T C 2: 181,259,026 T193A probably benign Het
Gnl3 A G 14: 31,014,163 S307P probably damaging Het
Golim4 A T 3: 75,892,859 F443I probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Klf10 A C 15: 38,297,113 Y228D probably benign Het
Klrc3 A T 6: 129,639,557 W166R probably damaging Het
Kng2 A T 16: 22,988,315 I378N probably benign Het
Map3k10 T C 7: 27,663,263 K466R possibly damaging Het
Mrrf C T 2: 36,189,097 T245M probably benign Het
Msi1 A G 5: 115,445,458 Y239C probably damaging Het
Nfasc A G 1: 132,597,763 probably null Het
Olfr1375 T A 11: 51,048,473 L122Q probably damaging Het
Olfr843 A T 9: 19,249,061 C113S probably benign Het
Pkd1l1 T C 11: 8,958,900 E368G unknown Het
Polq G A 16: 37,089,325 G2078D probably damaging Het
Ppfibp1 A C 6: 146,992,444 I134L probably damaging Het
Rasip1 A T 7: 45,634,823 I608F probably damaging Het
Ripk3 A T 14: 55,788,035 V24E probably damaging Het
Rtkn T A 6: 83,147,545 I110N probably damaging Het
Scn1a C T 2: 66,273,832 V1695I probably damaging Het
Shank2 A G 7: 144,052,305 N75S possibly damaging Het
Snu13 C A 15: 82,043,981 A14S probably benign Het
Snx27 A C 3: 94,531,234 D231E probably damaging Het
Spef2 A G 15: 9,725,197 I158T possibly damaging Het
Sptb A G 12: 76,649,869 I19T possibly damaging Het
Tecr C T 8: 83,572,575 V248I probably benign Het
Tnfrsf13b T G 11: 61,141,476 S59A probably benign Het
Tom1l1 T C 11: 90,671,125 T150A possibly damaging Het
Ubr3 A T 2: 69,936,018 Y410F probably damaging Het
Vmn2r108 A G 17: 20,472,315 I93T probably damaging Het
Vmn2r19 A G 6: 123,329,978 T482A probably benign Het
Vstm4 T A 14: 32,863,707 M77K probably benign Het
Zbtb17 C T 4: 141,464,585 T309I probably damaging Het
Zfp957 T C 14: 79,214,054 T102A probably damaging Het
Other mutations in Ssu72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02126:Ssu72 APN 4 155732026 missense probably benign 0.37
IGL02601:Ssu72 APN 4 155705425 missense possibly damaging 0.90
R1575:Ssu72 UTSW 4 155731357 missense probably benign 0.03
R2145:Ssu72 UTSW 4 155705443 missense probably damaging 0.98
R3935:Ssu72 UTSW 4 155705419 missense probably benign 0.28
R4542:Ssu72 UTSW 4 155733477 missense probably benign 0.00
R4851:Ssu72 UTSW 4 155715596 missense possibly damaging 0.51
R5419:Ssu72 UTSW 4 155715550 missense probably damaging 1.00
R6524:Ssu72 UTSW 4 155715540 missense probably null 1.00
R7146:Ssu72 UTSW 4 155731393 missense probably damaging 0.99
R7530:Ssu72 UTSW 4 155731329 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAATCTAGCCGTCCCACTC -3'
(R):5'- GCGTACGTCTCATTCCATATGTAC -3'

Sequencing Primer
(F):5'- CCAATATGGGGTACTCCTATGATATG -3'
(R):5'- ACGTCTCATTCCATATGTACAGTAC -3'
Posted On2014-12-04