Incidental Mutation 'R0315:Slc16a14'
ID 25391
Institutional Source Beutler Lab
Gene Symbol Slc16a14
Ensembl Gene ENSMUSG00000026220
Gene Name solute carrier family 16 (monocarboxylic acid transporters), member 14
Synonyms 1110004H10Rik
MMRRC Submission 038525-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock # R0315 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 84905898-84935134 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 84912496 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 363 (I363V)
Ref Sequence ENSEMBL: ENSMUSP00000027422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027422]
AlphaFold Q8K1C7
Predicted Effect possibly damaging
Transcript: ENSMUST00000027422
AA Change: I363V

PolyPhen 2 Score 0.457 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027422
Gene: ENSMUSG00000026220
AA Change: I363V

DomainStartEndE-ValueType
Pfam:MFS_1 42 427 6.7e-42 PFAM
Pfam:MFS_1 419 509 7.9e-10 PFAM
Meta Mutation Damage Score 0.0893 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.9%
  • 20x: 88.9%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 G A 17: 45,515,452 R409Q possibly damaging Het
Ank3 A T 10: 70,002,517 Q825L probably damaging Het
Ap1g1 A G 8: 109,819,035 I107V probably benign Het
Bub1b A T 2: 118,626,976 probably benign Het
Cd86 C T 16: 36,620,944 V54I possibly damaging Het
Dpys T G 15: 39,857,338 I9L probably benign Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Flg2 G T 3: 93,214,722 G1400C unknown Het
Gm28042 T C 2: 120,039,057 L634P probably damaging Het
Gm6712 G A 17: 17,316,118 noncoding transcript Het
Gpbp1 T G 13: 111,436,538 E360A possibly damaging Het
Hmgn1 A C 16: 96,124,817 I52R probably benign Het
Ing2 A C 8: 47,669,090 M141R probably benign Het
Klhl2 A T 8: 64,743,019 Y563* probably null Het
Lrrc9 A G 12: 72,456,028 T258A probably damaging Het
Map1b A T 13: 99,431,116 I1699N unknown Het
Map2k5 A T 9: 63,303,151 H185Q probably damaging Het
Mpv17l A T 16: 13,940,999 I96L probably benign Het
Mroh1 C T 15: 76,427,600 A511V possibly damaging Het
Nop53 T C 7: 15,945,310 D90G probably damaging Het
Olfr1153 A T 2: 87,897,066 Y289F probably damaging Het
Olfr1447 A T 19: 12,901,234 V182D possibly damaging Het
Olfr370 T C 8: 83,541,372 V76A possibly damaging Het
Olfr799 T A 10: 129,647,497 I123N probably damaging Het
Pkd2 T A 5: 104,459,850 S72T possibly damaging Het
Prc1 T C 7: 80,313,536 S587P probably damaging Het
Rdh7 G T 10: 127,888,396 T73K possibly damaging Het
Runx1 T C 16: 92,605,767 N429S probably damaging Het
Skint7 G A 4: 111,988,118 A376T possibly damaging Het
Smarcal1 C T 1: 72,595,811 Q350* probably null Het
Soat1 T A 1: 156,440,513 K275* probably null Het
Speg T C 1: 75,415,136 V1571A possibly damaging Het
Stat5b G C 11: 100,788,460 D605E probably benign Het
Susd4 G A 1: 182,858,512 R209H probably benign Het
Tlr1 T G 5: 64,926,928 D102A probably damaging Het
Tm4sf5 A G 11: 70,510,636 N154D probably damaging Het
Tmigd3 T A 3: 105,916,769 M18K probably damaging Het
Ube2h A T 6: 30,241,413 V86E probably damaging Het
Utp20 A G 10: 88,807,421 L613P probably damaging Het
Vmn2r117 G A 17: 23,460,165 S695L probably benign Het
Washc5 T C 15: 59,341,976 D427G probably damaging Het
Zfp462 T A 4: 55,079,314 F2403I probably damaging Het
Other mutations in Slc16a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Slc16a14 APN 1 84922871 missense probably damaging 0.99
IGL01563:Slc16a14 APN 1 84912187 splice site probably benign
R0380:Slc16a14 UTSW 1 84929530 missense possibly damaging 0.72
R1469:Slc16a14 UTSW 1 84929461 missense probably damaging 1.00
R1469:Slc16a14 UTSW 1 84929461 missense probably damaging 1.00
R1837:Slc16a14 UTSW 1 84912399 missense probably benign 0.02
R2149:Slc16a14 UTSW 1 84907399 missense probably damaging 1.00
R2293:Slc16a14 UTSW 1 84912843 missense probably benign
R3790:Slc16a14 UTSW 1 84929280 unclassified probably benign
R4016:Slc16a14 UTSW 1 84912507 nonsense probably null
R4596:Slc16a14 UTSW 1 84929357 missense probably damaging 1.00
R4637:Slc16a14 UTSW 1 84907282 missense possibly damaging 0.86
R4723:Slc16a14 UTSW 1 84913020 missense probably damaging 1.00
R5137:Slc16a14 UTSW 1 84912597 missense probably damaging 1.00
R5262:Slc16a14 UTSW 1 84912891 missense probably benign 0.00
R5410:Slc16a14 UTSW 1 84907424 missense probably damaging 0.98
R5927:Slc16a14 UTSW 1 84912267 missense possibly damaging 0.91
R5968:Slc16a14 UTSW 1 84912505 missense possibly damaging 0.70
R6052:Slc16a14 UTSW 1 84912709 missense possibly damaging 0.75
R6264:Slc16a14 UTSW 1 84907409 missense probably benign 0.30
R6290:Slc16a14 UTSW 1 84907385 missense probably benign 0.10
R7383:Slc16a14 UTSW 1 84912571 missense probably damaging 1.00
R7390:Slc16a14 UTSW 1 84929466 missense probably benign 0.25
R7535:Slc16a14 UTSW 1 84913122 missense probably damaging 1.00
R8326:Slc16a14 UTSW 1 84912345 missense possibly damaging 0.94
R8669:Slc16a14 UTSW 1 84922884 missense probably benign 0.00
R8784:Slc16a14 UTSW 1 84913063 missense probably benign 0.01
R9409:Slc16a14 UTSW 1 84929395 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGGCGCAGATGATGATGCCGTAG -3'
(R):5'- ATTTTGGGACGGCTTCACTCTTCAC -3'

Sequencing Primer
(F):5'- TCTGTCACCACAGGCATGAG -3'
(R):5'- ACCAACCGCATGTTTGTAGC -3'
Posted On 2013-04-16