Incidental Mutation 'R2517:Ppfibp1'
ID253929
Institutional Source Beutler Lab
Gene Symbol Ppfibp1
Ensembl Gene ENSMUSG00000016487
Gene NamePTPRF interacting protein, binding protein 1 (liprin beta 1)
Synonyms
MMRRC Submission 040421-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.485) question?
Stock #R2517 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location146888487-147032025 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 146992444 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 134 (I134L)
Ref Sequence ENSEMBL: ENSMUSP00000107250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016631] [ENSMUST00000111623] [ENSMUST00000154221] [ENSMUST00000204660]
Predicted Effect probably damaging
Transcript: ENSMUST00000016631
AA Change: I134L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000016631
Gene: ENSMUSG00000016487
AA Change: I134L

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
PDB:3QH9|A 180 256 3e-8 PDB
low complexity region 345 358 N/A INTRINSIC
low complexity region 426 441 N/A INTRINSIC
low complexity region 530 546 N/A INTRINSIC
SAM 603 670 3.06e-13 SMART
SAM 675 741 2.39e-15 SMART
SAM 763 835 7.91e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111623
AA Change: I134L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000107250
Gene: ENSMUSG00000016487
AA Change: I134L

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
PDB:3QH9|A 180 256 3e-8 PDB
low complexity region 272 284 N/A INTRINSIC
low complexity region 356 369 N/A INTRINSIC
low complexity region 437 452 N/A INTRINSIC
low complexity region 541 557 N/A INTRINSIC
SAM 614 681 3.06e-13 SMART
SAM 686 752 2.39e-15 SMART
SAM 774 846 7.91e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126774
Predicted Effect probably benign
Transcript: ENSMUST00000154221
SMART Domains Protein: ENSMUSP00000122515
Gene: ENSMUSG00000016487

DomainStartEndE-ValueType
coiled coil region 7 196 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204660
SMART Domains Protein: ENSMUSP00000144887
Gene: ENSMUSG00000016487

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
coiled coil region 99 130 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205056
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the LAR protein-tyrosine phosphatase-interacting protein (liprin) family. Liprins interact with members of LAR family of transmembrane protein tyrosine phosphatases, which are known to be important for axon guidance and mammary gland development. It has been proposed that liprins are multivalent proteins that form complex structures and act as scaffolds for the recruitment and anchoring of LAR family of tyrosine phosphatases. This protein was found to interact with S100A4, a calcium-binding protein related to tumor invasiveness and metastasis. In vitro experiment demonstrated that the interaction inhibited the phosphorylation of this protein by protein kinase C and protein kinase CK2. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700042G07Rik A G 4: 116,173,594 D65G probably benign Het
Adcy4 C A 14: 55,781,946 E82D probably damaging Het
AF067061 T A 13: 120,263,939 C46* probably null Het
Ago1 G A 4: 126,439,939 R486* probably null Het
Ago2 T A 15: 73,124,242 N346I possibly damaging Het
Apol11a A T 15: 77,517,195 D294V probably benign Het
Atp13a5 A G 16: 29,297,397 F634L possibly damaging Het
Atp2a2 G A 5: 122,457,513 P953L probably damaging Het
Brca2 A G 5: 150,539,672 D967G probably benign Het
Bud13 A T 9: 46,288,148 H269L probably benign Het
Cachd1 A T 4: 100,980,882 probably null Het
Cog3 T C 14: 75,741,742 D188G probably benign Het
Col15a1 T C 4: 47,208,492 S20P probably damaging Het
Col4a3 A G 1: 82,680,710 D838G unknown Het
Cwh43 A T 5: 73,421,543 T298S probably benign Het
Dip2c A G 13: 9,609,005 R847G probably damaging Het
Dnah2 C T 11: 69,516,644 D438N probably damaging Het
Drg2 T C 11: 60,468,128 V358A probably damaging Het
Eif4enif1 T A 11: 3,221,168 W220R probably damaging Het
Enpp2 A T 15: 54,919,694 I75K probably damaging Het
Fam110c T C 12: 31,075,239 I400T probably damaging Het
Fam193b C A 13: 55,542,816 R711L probably damaging Het
Fgfr1 T C 8: 25,563,446 Y246H probably damaging Het
Frs3 G A 17: 47,703,072 R230Q probably benign Het
Galnt5 A G 2: 57,999,413 K342E probably benign Het
Glrb A T 3: 80,861,747 L189Q probably damaging Het
Gmeb2 T C 2: 181,259,026 T193A probably benign Het
Gnl3 A G 14: 31,014,163 S307P probably damaging Het
Golim4 A T 3: 75,892,859 F443I probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Klf10 A C 15: 38,297,113 Y228D probably benign Het
Klrc3 A T 6: 129,639,557 W166R probably damaging Het
Kng2 A T 16: 22,988,315 I378N probably benign Het
Map3k10 T C 7: 27,663,263 K466R possibly damaging Het
Mrrf C T 2: 36,189,097 T245M probably benign Het
Msi1 A G 5: 115,445,458 Y239C probably damaging Het
Nfasc A G 1: 132,597,763 probably null Het
Olfr1375 T A 11: 51,048,473 L122Q probably damaging Het
Olfr843 A T 9: 19,249,061 C113S probably benign Het
Pkd1l1 T C 11: 8,958,900 E368G unknown Het
Polq G A 16: 37,089,325 G2078D probably damaging Het
Rasip1 A T 7: 45,634,823 I608F probably damaging Het
Ripk3 A T 14: 55,788,035 V24E probably damaging Het
Rtkn T A 6: 83,147,545 I110N probably damaging Het
Scn1a C T 2: 66,273,832 V1695I probably damaging Het
Shank2 A G 7: 144,052,305 N75S possibly damaging Het
Snu13 C A 15: 82,043,981 A14S probably benign Het
Snx27 A C 3: 94,531,234 D231E probably damaging Het
Spef2 A G 15: 9,725,197 I158T possibly damaging Het
Sptb A G 12: 76,649,869 I19T possibly damaging Het
Ssu72 T C 4: 155,733,513 L175P probably damaging Het
Tecr C T 8: 83,572,575 V248I probably benign Het
Tnfrsf13b T G 11: 61,141,476 S59A probably benign Het
Tom1l1 T C 11: 90,671,125 T150A possibly damaging Het
Ubr3 A T 2: 69,936,018 Y410F probably damaging Het
Vmn2r108 A G 17: 20,472,315 I93T probably damaging Het
Vmn2r19 A G 6: 123,329,978 T482A probably benign Het
Vstm4 T A 14: 32,863,707 M77K probably benign Het
Zbtb17 C T 4: 141,464,585 T309I probably damaging Het
Zfp957 T C 14: 79,214,054 T102A probably damaging Het
Other mutations in Ppfibp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Ppfibp1 APN 6 147029697 missense probably benign 0.07
IGL02644:Ppfibp1 APN 6 147022440 missense probably damaging 1.00
IGL02711:Ppfibp1 APN 6 147026238 nonsense probably null
IGL02737:Ppfibp1 APN 6 147027308 missense probably damaging 1.00
IGL02745:Ppfibp1 APN 6 147022354 unclassified probably benign
IGL03120:Ppfibp1 APN 6 146998169 missense probably benign 0.00
IGL03300:Ppfibp1 APN 6 147030327 missense probably damaging 1.00
R0114:Ppfibp1 UTSW 6 146998233 missense probably benign 0.04
R0480:Ppfibp1 UTSW 6 147019031 splice site probably null
R0699:Ppfibp1 UTSW 6 147026222 missense probably damaging 0.99
R1515:Ppfibp1 UTSW 6 147027432 missense probably benign
R1830:Ppfibp1 UTSW 6 147022259 critical splice donor site probably null
R1858:Ppfibp1 UTSW 6 146990592 missense probably benign 0.06
R2160:Ppfibp1 UTSW 6 147027453 missense probably damaging 0.98
R2389:Ppfibp1 UTSW 6 147022171 missense probably damaging 1.00
R3882:Ppfibp1 UTSW 6 146998221 missense possibly damaging 0.67
R4035:Ppfibp1 UTSW 6 146996836 missense probably damaging 0.99
R4202:Ppfibp1 UTSW 6 147029581 missense probably damaging 1.00
R4205:Ppfibp1 UTSW 6 147029581 missense probably damaging 1.00
R4420:Ppfibp1 UTSW 6 147026238 nonsense probably null
R4860:Ppfibp1 UTSW 6 146990514 missense probably benign 0.01
R4860:Ppfibp1 UTSW 6 146990514 missense probably benign 0.01
R4974:Ppfibp1 UTSW 6 147030419 utr 3 prime probably benign
R5163:Ppfibp1 UTSW 6 147022131 splice site probably null
R5180:Ppfibp1 UTSW 6 147027321 missense probably damaging 1.00
R5388:Ppfibp1 UTSW 6 146996840 missense probably damaging 1.00
R5388:Ppfibp1 UTSW 6 147016330 missense probably damaging 1.00
R5458:Ppfibp1 UTSW 6 147012435 intron probably benign
R5479:Ppfibp1 UTSW 6 147030150 critical splice donor site probably null
R5631:Ppfibp1 UTSW 6 146996860 missense probably damaging 1.00
R6277:Ppfibp1 UTSW 6 147005924 missense probably benign 0.01
R6577:Ppfibp1 UTSW 6 146999655 splice site probably null
R6602:Ppfibp1 UTSW 6 146978221 missense possibly damaging 0.62
R7320:Ppfibp1 UTSW 6 146978053 missense probably damaging 1.00
R7440:Ppfibp1 UTSW 6 147019503 missense probably benign 0.01
R7455:Ppfibp1 UTSW 6 147016350 missense probably damaging 1.00
R7710:Ppfibp1 UTSW 6 146996405 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCAAAGGGTAGGACCACTGTC -3'
(R):5'- AGACTCTGCTACTCTAGACTTCAAAC -3'

Sequencing Primer
(F):5'- GACCACTGTCCTCTTGTTAAGTTTG -3'
(R):5'- CAAACAAAACAGTCTAGGGATTCTG -3'
Posted On2014-12-04