Incidental Mutation 'R2517:Map3k10'
ID253932
Institutional Source Beutler Lab
Gene Symbol Map3k10
Ensembl Gene ENSMUSG00000040390
Gene Namemitogen-activated protein kinase kinase kinase 10
SynonymsMlk2, serine/threonine kinase, MKN28 derived nonreceptor_type, mixed lineage kinase 2, MKN28 kinase
MMRRC Submission 040421-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2517 (G1)
Quality Score178
Status Not validated
Chromosome7
Chromosomal Location27656375-27674598 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27663263 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 466 (K466R)
Ref Sequence ENSEMBL: ENSMUSP00000103978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036453] [ENSMUST00000108341] [ENSMUST00000138243]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036453
AA Change: K466R

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000037725
Gene: ENSMUSG00000040390
AA Change: K466R

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
SH3 19 80 6e-20 SMART
Pfam:Pkinase 98 357 7.4e-59 PFAM
Pfam:Pkinase_Tyr 98 357 3.8e-62 PFAM
coiled coil region 378 449 N/A INTRINSIC
low complexity region 501 511 N/A INTRINSIC
low complexity region 524 550 N/A INTRINSIC
low complexity region 665 676 N/A INTRINSIC
low complexity region 761 778 N/A INTRINSIC
low complexity region 835 847 N/A INTRINSIC
low complexity region 870 881 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108341
AA Change: K466R

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103978
Gene: ENSMUSG00000040390
AA Change: K466R

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
SH3 19 80 6e-20 SMART
Pfam:Pkinase_Tyr 98 357 2e-62 PFAM
Pfam:Pkinase 98 358 4.8e-59 PFAM
coiled coil region 378 449 N/A INTRINSIC
low complexity region 501 511 N/A INTRINSIC
low complexity region 524 550 N/A INTRINSIC
low complexity region 665 676 N/A INTRINSIC
low complexity region 761 778 N/A INTRINSIC
low complexity region 837 849 N/A INTRINSIC
low complexity region 872 883 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133551
Predicted Effect probably benign
Transcript: ENSMUST00000138243
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152032
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serine/threonine kinase family. This kinase has been shown to activate MAPK8/JNK and MKK4/SEK1, and this kinase itself can be phoshorylated, and thus activated by JNK kinases. This kinase functions preferentially on the JNK signaling pathway, and is reported to be involved in nerve growth factor (NGF) induced neuronal apoptosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit normal development, reproduction and lifespan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700042G07Rik A G 4: 116,173,594 D65G probably benign Het
Adcy4 C A 14: 55,781,946 E82D probably damaging Het
AF067061 T A 13: 120,263,939 C46* probably null Het
Ago1 G A 4: 126,439,939 R486* probably null Het
Ago2 T A 15: 73,124,242 N346I possibly damaging Het
Apol11a A T 15: 77,517,195 D294V probably benign Het
Atp13a5 A G 16: 29,297,397 F634L possibly damaging Het
Atp2a2 G A 5: 122,457,513 P953L probably damaging Het
Brca2 A G 5: 150,539,672 D967G probably benign Het
Bud13 A T 9: 46,288,148 H269L probably benign Het
Cachd1 A T 4: 100,980,882 probably null Het
Cog3 T C 14: 75,741,742 D188G probably benign Het
Col15a1 T C 4: 47,208,492 S20P probably damaging Het
Col4a3 A G 1: 82,680,710 D838G unknown Het
Cwh43 A T 5: 73,421,543 T298S probably benign Het
Dip2c A G 13: 9,609,005 R847G probably damaging Het
Dnah2 C T 11: 69,516,644 D438N probably damaging Het
Drg2 T C 11: 60,468,128 V358A probably damaging Het
Eif4enif1 T A 11: 3,221,168 W220R probably damaging Het
Enpp2 A T 15: 54,919,694 I75K probably damaging Het
Fam110c T C 12: 31,075,239 I400T probably damaging Het
Fam193b C A 13: 55,542,816 R711L probably damaging Het
Fgfr1 T C 8: 25,563,446 Y246H probably damaging Het
Frs3 G A 17: 47,703,072 R230Q probably benign Het
Galnt5 A G 2: 57,999,413 K342E probably benign Het
Glrb A T 3: 80,861,747 L189Q probably damaging Het
Gmeb2 T C 2: 181,259,026 T193A probably benign Het
Gnl3 A G 14: 31,014,163 S307P probably damaging Het
Golim4 A T 3: 75,892,859 F443I probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Klf10 A C 15: 38,297,113 Y228D probably benign Het
Klrc3 A T 6: 129,639,557 W166R probably damaging Het
Kng2 A T 16: 22,988,315 I378N probably benign Het
Mrrf C T 2: 36,189,097 T245M probably benign Het
Msi1 A G 5: 115,445,458 Y239C probably damaging Het
Nfasc A G 1: 132,597,763 probably null Het
Olfr1375 T A 11: 51,048,473 L122Q probably damaging Het
Olfr843 A T 9: 19,249,061 C113S probably benign Het
Pkd1l1 T C 11: 8,958,900 E368G unknown Het
Polq G A 16: 37,089,325 G2078D probably damaging Het
Ppfibp1 A C 6: 146,992,444 I134L probably damaging Het
Rasip1 A T 7: 45,634,823 I608F probably damaging Het
Ripk3 A T 14: 55,788,035 V24E probably damaging Het
Rtkn T A 6: 83,147,545 I110N probably damaging Het
Scn1a C T 2: 66,273,832 V1695I probably damaging Het
Shank2 A G 7: 144,052,305 N75S possibly damaging Het
Snu13 C A 15: 82,043,981 A14S probably benign Het
Snx27 A C 3: 94,531,234 D231E probably damaging Het
Spef2 A G 15: 9,725,197 I158T possibly damaging Het
Sptb A G 12: 76,649,869 I19T possibly damaging Het
Ssu72 T C 4: 155,733,513 L175P probably damaging Het
Tecr C T 8: 83,572,575 V248I probably benign Het
Tnfrsf13b T G 11: 61,141,476 S59A probably benign Het
Tom1l1 T C 11: 90,671,125 T150A possibly damaging Het
Ubr3 A T 2: 69,936,018 Y410F probably damaging Het
Vmn2r108 A G 17: 20,472,315 I93T probably damaging Het
Vmn2r19 A G 6: 123,329,978 T482A probably benign Het
Vstm4 T A 14: 32,863,707 M77K probably benign Het
Zbtb17 C T 4: 141,464,585 T309I probably damaging Het
Zfp957 T C 14: 79,214,054 T102A probably damaging Het
Other mutations in Map3k10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Map3k10 APN 7 27668469 missense probably damaging 1.00
IGL00672:Map3k10 APN 7 27661601 missense probably damaging 0.98
IGL00913:Map3k10 APN 7 27663215 unclassified probably benign
IGL01383:Map3k10 APN 7 27657999 missense probably benign 0.15
IGL02683:Map3k10 APN 7 27658937 missense probably damaging 1.00
R0039:Map3k10 UTSW 7 27658098 missense possibly damaging 0.95
R0219:Map3k10 UTSW 7 27656731 missense probably damaging 1.00
R0285:Map3k10 UTSW 7 27673900 missense probably benign 0.00
R0368:Map3k10 UTSW 7 27663360 missense probably damaging 0.98
R0724:Map3k10 UTSW 7 27668355 missense probably damaging 1.00
R0729:Map3k10 UTSW 7 27661567 missense probably damaging 1.00
R1734:Map3k10 UTSW 7 27658115 missense probably damaging 1.00
R1847:Map3k10 UTSW 7 27661556 unclassified probably null
R2395:Map3k10 UTSW 7 27673993 missense unknown
R3841:Map3k10 UTSW 7 27658364 missense possibly damaging 0.91
R4749:Map3k10 UTSW 7 27658361 missense possibly damaging 0.78
R5269:Map3k10 UTSW 7 27658532 missense probably benign 0.01
R5822:Map3k10 UTSW 7 27656734 missense probably damaging 1.00
R6059:Map3k10 UTSW 7 27656822 missense probably damaging 0.99
R6417:Map3k10 UTSW 7 27663284 missense probably damaging 1.00
R6420:Map3k10 UTSW 7 27663284 missense probably damaging 1.00
R7903:Map3k10 UTSW 7 27657957 missense probably damaging 0.99
R7986:Map3k10 UTSW 7 27657957 missense probably damaging 0.99
X0020:Map3k10 UTSW 7 27664462 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTTTAAGATGCTGAGGGTGC -3'
(R):5'- TGTGAACTCAGAGCCGATGC -3'

Sequencing Primer
(F):5'- CAGCTCGGTGGGAAAACC -3'
(R):5'- AGCTAAGCCCTACCTCTGG -3'
Posted On2014-12-04