Incidental Mutation 'R0315:Bub1b'
ID25395
Institutional Source Beutler Lab
Gene Symbol Bub1b
Ensembl Gene ENSMUSG00000040084
Gene NameBUB1B, mitotic checkpoint serine/threonine kinase
SynonymsBUBR1
MMRRC Submission 038525-MU
Accession Numbers

NM_009773; MGI: 1333889

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0315 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location118598211-118641591 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 118626976 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000037126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038341]
Predicted Effect probably benign
Transcript: ENSMUST00000038341
SMART Domains Protein: ENSMUSP00000037126
Gene: ENSMUSG00000040084

DomainStartEndE-ValueType
PDB:4GGD|D 14 35 6e-6 PDB
Mad3_BUB1_I 49 173 1.83e-68 SMART
low complexity region 198 214 N/A INTRINSIC
low complexity region 382 395 N/A INTRINSIC
coiled coil region 418 457 N/A INTRINSIC
low complexity region 671 686 N/A INTRINSIC
low complexity region 717 726 N/A INTRINSIC
Pfam:Pkinase 806 942 4.5e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126013
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130512
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.9%
  • 20x: 88.9%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kinase involved in spindle checkpoint function. The protein has been localized to the kinetochore and plays a role in the inhibition of the anaphase-promoting complex/cyclosome (APC/C), delaying the onset of anaphase and ensuring proper chromosome segregation. Impaired spindle checkpoint function has been found in many forms of cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant embryos undergo extensive apoptosis and die during early gestation. Heterozygous mice are viable and exhibit splenomegaly, abnormal megakaryopoiesis, and an increased susceptibility to intestinal tumorigenesis. Hypomorphic homozygotes display infertility and premature aging. [provided by MGI curators]
Allele List at MGI

All alleles(22) : Targeted, knock-out(1) Targeted, other(3) Gene trapped(18)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 G A 17: 45,515,452 R409Q possibly damaging Het
Ank3 A T 10: 70,002,517 Q825L probably damaging Het
Ap1g1 A G 8: 109,819,035 I107V probably benign Het
Cd86 C T 16: 36,620,944 V54I possibly damaging Het
Dpys T G 15: 39,857,338 I9L probably benign Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Flg2 G T 3: 93,214,722 G1400C unknown Het
Gm28042 T C 2: 120,039,057 L634P probably damaging Het
Gm6712 G A 17: 17,316,118 noncoding transcript Het
Gpbp1 T G 13: 111,436,538 E360A possibly damaging Het
Hmgn1 A C 16: 96,124,817 I52R probably benign Het
Ing2 A C 8: 47,669,090 M141R probably benign Het
Klhl2 A T 8: 64,743,019 Y563* probably null Het
Lrrc9 A G 12: 72,456,028 T258A probably damaging Het
Map1b A T 13: 99,431,116 I1699N unknown Het
Map2k5 A T 9: 63,303,151 H185Q probably damaging Het
Mpv17l A T 16: 13,940,999 I96L probably benign Het
Mroh1 C T 15: 76,427,600 A511V possibly damaging Het
Nop53 T C 7: 15,945,310 D90G probably damaging Het
Olfr1153 A T 2: 87,897,066 Y289F probably damaging Het
Olfr1447 A T 19: 12,901,234 V182D possibly damaging Het
Olfr370 T C 8: 83,541,372 V76A possibly damaging Het
Olfr799 T A 10: 129,647,497 I123N probably damaging Het
Pkd2 T A 5: 104,459,850 S72T possibly damaging Het
Prc1 T C 7: 80,313,536 S587P probably damaging Het
Rdh7 G T 10: 127,888,396 T73K possibly damaging Het
Runx1 T C 16: 92,605,767 N429S probably damaging Het
Skint7 G A 4: 111,988,118 A376T possibly damaging Het
Slc16a14 T C 1: 84,912,496 I363V possibly damaging Het
Smarcal1 C T 1: 72,595,811 Q350* probably null Het
Soat1 T A 1: 156,440,513 K275* probably null Het
Speg T C 1: 75,415,136 V1571A possibly damaging Het
Stat5b G C 11: 100,788,460 D605E probably benign Het
Susd4 G A 1: 182,858,512 R209H probably benign Het
Tlr1 T G 5: 64,926,928 D102A probably damaging Het
Tm4sf5 A G 11: 70,510,636 N154D probably damaging Het
Tmigd3 T A 3: 105,916,769 M18K probably damaging Het
Ube2h A T 6: 30,241,413 V86E probably damaging Het
Utp20 A G 10: 88,807,421 L613P probably damaging Het
Vmn2r117 G A 17: 23,460,165 S695L probably benign Het
Washc5 T C 15: 59,341,976 D427G probably damaging Het
Zfp462 T A 4: 55,079,314 F2403I probably damaging Het
Other mutations in Bub1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00676:Bub1b APN 2 118630138 missense probably benign
IGL01319:Bub1b APN 2 118614994 missense possibly damaging 0.49
IGL01744:Bub1b APN 2 118636749 missense probably damaging 0.99
IGL03184:Bub1b APN 2 118609777 splice site probably benign
P0035:Bub1b UTSW 2 118622185 missense probably damaging 1.00
R0322:Bub1b UTSW 2 118639618 splice site probably benign
R0378:Bub1b UTSW 2 118641123 missense probably benign 0.01
R0457:Bub1b UTSW 2 118609859 missense probably damaging 1.00
R0845:Bub1b UTSW 2 118609976 missense probably damaging 1.00
R0960:Bub1b UTSW 2 118606680 missense probably benign 0.03
R1071:Bub1b UTSW 2 118632447 frame shift probably null
R1129:Bub1b UTSW 2 118615006 missense probably damaging 1.00
R1138:Bub1b UTSW 2 118623089 missense probably benign 0.01
R1171:Bub1b UTSW 2 118606686 missense probably benign 0.31
R1613:Bub1b UTSW 2 118639741 critical splice donor site probably null
R1667:Bub1b UTSW 2 118641189 missense probably benign 0.00
R1812:Bub1b UTSW 2 118632421 missense probably benign 0.00
R1828:Bub1b UTSW 2 118638439 missense probably benign 0.00
R2085:Bub1b UTSW 2 118622195 missense possibly damaging 0.88
R2137:Bub1b UTSW 2 118636718 nonsense probably null
R3749:Bub1b UTSW 2 118615455 missense possibly damaging 0.63
R3750:Bub1b UTSW 2 118615455 missense possibly damaging 0.63
R4211:Bub1b UTSW 2 118630978 missense possibly damaging 0.78
R4579:Bub1b UTSW 2 118623176 nonsense probably null
R4993:Bub1b UTSW 2 118636770 missense possibly damaging 0.63
R5144:Bub1b UTSW 2 118615499 missense possibly damaging 0.92
R5229:Bub1b UTSW 2 118629989 missense probably damaging 1.00
R5596:Bub1b UTSW 2 118630982 missense probably damaging 1.00
R5656:Bub1b UTSW 2 118605431 missense probably damaging 1.00
R5785:Bub1b UTSW 2 118609844 missense probably damaging 0.98
R5883:Bub1b UTSW 2 118609882 missense probably damaging 1.00
R6128:Bub1b UTSW 2 118617812 missense probably benign
R6187:Bub1b UTSW 2 118631000 missense probably damaging 1.00
R6333:Bub1b UTSW 2 118598463 critical splice donor site probably null
R6985:Bub1b UTSW 2 118606614 missense probably damaging 1.00
R6988:Bub1b UTSW 2 118636830 missense probably damaging 0.96
R7161:Bub1b UTSW 2 118626053 missense probably damaging 1.00
R7341:Bub1b UTSW 2 118636786 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGCAATAACAGGGAGTGCTAACTGG -3'
(R):5'- AAGTCCACTGTCCATTACAACAGGC -3'

Sequencing Primer
(F):5'- CAGGGAGTGCTAACTGGAATATG -3'
(R):5'- CCGTCTGTGTCAGGGAAAGTC -3'
Posted On2013-04-16