Incidental Mutation 'R2517:Eif4enif1'
ID253950
Institutional Source Beutler Lab
Gene Symbol Eif4enif1
Ensembl Gene ENSMUSG00000020454
Gene Nameeukaryotic translation initiation factor 4E nuclear import factor 1
SynonymsD11Ertd166e, 2610509L04Rik, Clast4, A930019J01Rik
MMRRC Submission 040421-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.652) question?
Stock #R2517 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location3202392-3244588 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3221168 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 220 (W220R)
Ref Sequence ENSEMBL: ENSMUSP00000020734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020734] [ENSMUST00000110048] [ENSMUST00000110049] [ENSMUST00000120721] [ENSMUST00000125637] [ENSMUST00000179770]
Predicted Effect probably damaging
Transcript: ENSMUST00000020734
AA Change: W220R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020734
Gene: ENSMUSG00000020454
AA Change: W220R

DomainStartEndE-ValueType
Pfam:EIF4E-T 29 688 1.2e-189 PFAM
low complexity region 835 851 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110048
AA Change: W220R

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105675
Gene: ENSMUSG00000020454
AA Change: W220R

DomainStartEndE-ValueType
Pfam:EIF4E-T 29 688 1.2e-189 PFAM
low complexity region 835 851 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110049
AA Change: W220R

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105676
Gene: ENSMUSG00000020454
AA Change: W220R

DomainStartEndE-ValueType
Pfam:EIF4E-T 29 712 2.7e-184 PFAM
low complexity region 859 875 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120721
SMART Domains Protein: ENSMUSP00000112550
Gene: ENSMUSG00000020454

DomainStartEndE-ValueType
Pfam:EIF4E-T 29 99 3.6e-29 PFAM
Pfam:EIF4E-T 98 327 5.1e-41 PFAM
Pfam:EIF4E-T 282 537 7.7e-30 PFAM
low complexity region 684 700 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125224
Predicted Effect probably benign
Transcript: ENSMUST00000125637
SMART Domains Protein: ENSMUSP00000118527
Gene: ENSMUSG00000020454

DomainStartEndE-ValueType
Pfam:EIF4E-T 29 194 1.5e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159304
SMART Domains Protein: ENSMUSP00000125536
Gene: ENSMUSG00000020457

DomainStartEndE-ValueType
Pfam:TGS 13 58 5.7e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179770
AA Change: W220R

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136768
Gene: ENSMUSG00000020454
AA Change: W220R

DomainStartEndE-ValueType
Pfam:EIF4E-T 29 710 4.3e-160 PFAM
low complexity region 859 875 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nucleocytoplasmic shuttle protein for the translation initiation factor eIF4E. This shuttle protein interacts with the importin alpha-beta complex to mediate nuclear import of eIF4E. It is predominantly cytoplasmic; its own nuclear import is regulated by a nuclear localization signal and nuclear export signals. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700042G07Rik A G 4: 116,173,594 D65G probably benign Het
Adcy4 C A 14: 55,781,946 E82D probably damaging Het
AF067061 T A 13: 120,263,939 C46* probably null Het
Ago1 G A 4: 126,439,939 R486* probably null Het
Ago2 T A 15: 73,124,242 N346I possibly damaging Het
Apol11a A T 15: 77,517,195 D294V probably benign Het
Atp13a5 A G 16: 29,297,397 F634L possibly damaging Het
Atp2a2 G A 5: 122,457,513 P953L probably damaging Het
Brca2 A G 5: 150,539,672 D967G probably benign Het
Bud13 A T 9: 46,288,148 H269L probably benign Het
Cachd1 A T 4: 100,980,882 probably null Het
Cog3 T C 14: 75,741,742 D188G probably benign Het
Col15a1 T C 4: 47,208,492 S20P probably damaging Het
Col4a3 A G 1: 82,680,710 D838G unknown Het
Cwh43 A T 5: 73,421,543 T298S probably benign Het
Dip2c A G 13: 9,609,005 R847G probably damaging Het
Dnah2 C T 11: 69,516,644 D438N probably damaging Het
Drg2 T C 11: 60,468,128 V358A probably damaging Het
Enpp2 A T 15: 54,919,694 I75K probably damaging Het
Fam110c T C 12: 31,075,239 I400T probably damaging Het
Fam193b C A 13: 55,542,816 R711L probably damaging Het
Fgfr1 T C 8: 25,563,446 Y246H probably damaging Het
Frs3 G A 17: 47,703,072 R230Q probably benign Het
Galnt5 A G 2: 57,999,413 K342E probably benign Het
Glrb A T 3: 80,861,747 L189Q probably damaging Het
Gmeb2 T C 2: 181,259,026 T193A probably benign Het
Gnl3 A G 14: 31,014,163 S307P probably damaging Het
Golim4 A T 3: 75,892,859 F443I probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Klf10 A C 15: 38,297,113 Y228D probably benign Het
Klrc3 A T 6: 129,639,557 W166R probably damaging Het
Kng2 A T 16: 22,988,315 I378N probably benign Het
Map3k10 T C 7: 27,663,263 K466R possibly damaging Het
Mrrf C T 2: 36,189,097 T245M probably benign Het
Msi1 A G 5: 115,445,458 Y239C probably damaging Het
Nfasc A G 1: 132,597,763 probably null Het
Olfr1375 T A 11: 51,048,473 L122Q probably damaging Het
Olfr843 A T 9: 19,249,061 C113S probably benign Het
Pkd1l1 T C 11: 8,958,900 E368G unknown Het
Polq G A 16: 37,089,325 G2078D probably damaging Het
Ppfibp1 A C 6: 146,992,444 I134L probably damaging Het
Rasip1 A T 7: 45,634,823 I608F probably damaging Het
Ripk3 A T 14: 55,788,035 V24E probably damaging Het
Rtkn T A 6: 83,147,545 I110N probably damaging Het
Scn1a C T 2: 66,273,832 V1695I probably damaging Het
Shank2 A G 7: 144,052,305 N75S possibly damaging Het
Snu13 C A 15: 82,043,981 A14S probably benign Het
Snx27 A C 3: 94,531,234 D231E probably damaging Het
Spef2 A G 15: 9,725,197 I158T possibly damaging Het
Sptb A G 12: 76,649,869 I19T possibly damaging Het
Ssu72 T C 4: 155,733,513 L175P probably damaging Het
Tecr C T 8: 83,572,575 V248I probably benign Het
Tnfrsf13b T G 11: 61,141,476 S59A probably benign Het
Tom1l1 T C 11: 90,671,125 T150A possibly damaging Het
Ubr3 A T 2: 69,936,018 Y410F probably damaging Het
Vmn2r108 A G 17: 20,472,315 I93T probably damaging Het
Vmn2r19 A G 6: 123,329,978 T482A probably benign Het
Vstm4 T A 14: 32,863,707 M77K probably benign Het
Zbtb17 C T 4: 141,464,585 T309I probably damaging Het
Zfp957 T C 14: 79,214,054 T102A probably damaging Het
Other mutations in Eif4enif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01139:Eif4enif1 APN 11 3221143 missense probably damaging 0.96
IGL02237:Eif4enif1 APN 11 3227876 nonsense probably null
IGL02372:Eif4enif1 APN 11 3229986 missense probably benign 0.09
PIT4283001:Eif4enif1 UTSW 11 3234464 missense probably damaging 1.00
R0079:Eif4enif1 UTSW 11 3242676 nonsense probably null
R1177:Eif4enif1 UTSW 11 3229902 missense probably damaging 1.00
R1220:Eif4enif1 UTSW 11 3239493 splice site probably benign
R1511:Eif4enif1 UTSW 11 3236278 missense probably benign 0.00
R1675:Eif4enif1 UTSW 11 3215686 missense probably benign 0.02
R1908:Eif4enif1 UTSW 11 3227455 missense probably damaging 1.00
R1940:Eif4enif1 UTSW 11 3243279 missense probably damaging 1.00
R2173:Eif4enif1 UTSW 11 3242367 splice site probably null
R2215:Eif4enif1 UTSW 11 3227476 missense probably damaging 1.00
R2869:Eif4enif1 UTSW 11 3242586 missense probably damaging 1.00
R2869:Eif4enif1 UTSW 11 3242586 missense probably damaging 1.00
R2870:Eif4enif1 UTSW 11 3242586 missense probably damaging 1.00
R2870:Eif4enif1 UTSW 11 3242586 missense probably damaging 1.00
R2871:Eif4enif1 UTSW 11 3242586 missense probably damaging 1.00
R2871:Eif4enif1 UTSW 11 3242586 missense probably damaging 1.00
R2873:Eif4enif1 UTSW 11 3242586 missense probably damaging 1.00
R3147:Eif4enif1 UTSW 11 3244003 unclassified probably null
R4195:Eif4enif1 UTSW 11 3243186 missense possibly damaging 0.89
R4196:Eif4enif1 UTSW 11 3243186 missense possibly damaging 0.89
R4708:Eif4enif1 UTSW 11 3220323 missense probably damaging 1.00
R4755:Eif4enif1 UTSW 11 3244016 missense probably damaging 1.00
R5310:Eif4enif1 UTSW 11 3242687 missense probably damaging 1.00
R5546:Eif4enif1 UTSW 11 3243989 missense probably damaging 0.99
R5816:Eif4enif1 UTSW 11 3242401 missense probably benign 0.13
R6018:Eif4enif1 UTSW 11 3242481 missense probably damaging 0.97
R6036:Eif4enif1 UTSW 11 3239420 missense probably damaging 1.00
R6036:Eif4enif1 UTSW 11 3239420 missense probably damaging 1.00
R6267:Eif4enif1 UTSW 11 3227793 missense probably damaging 1.00
R6514:Eif4enif1 UTSW 11 3240996 missense probably null 0.01
R6638:Eif4enif1 UTSW 11 3242463 missense probably damaging 0.96
R7040:Eif4enif1 UTSW 11 3234040 missense probably benign 0.33
R7232:Eif4enif1 UTSW 11 3215678 missense possibly damaging 0.75
R7385:Eif4enif1 UTSW 11 3220269 missense probably damaging 1.00
R7478:Eif4enif1 UTSW 11 3227709 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGCACAGCTTCTGCATTTCAG -3'
(R):5'- AGCTTACTGTTTACAAACTGGC -3'

Sequencing Primer
(F):5'- GCATTTCAGCTGCTGTCATCAG -3'
(R):5'- CCTGTGCAGTTAAAACAATCCTCATG -3'
Posted On2014-12-04