Incidental Mutation 'R2517:Drg2'
ID253957
Institutional Source Beutler Lab
Gene Symbol Drg2
Ensembl Gene ENSMUSG00000020537
Gene Namedevelopmentally regulated GTP binding protein 2
Synonyms
MMRRC Submission 040421-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.931) question?
Stock #R2517 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location60454591-60468754 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60468128 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 358 (V358A)
Ref Sequence ENSEMBL: ENSMUSP00000018568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018568] [ENSMUST00000071880] [ENSMUST00000081823] [ENSMUST00000094135]
Predicted Effect probably damaging
Transcript: ENSMUST00000018568
AA Change: V358A

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000018568
Gene: ENSMUSG00000020537
AA Change: V358A

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:FeoB_N 63 169 1.4e-10 PFAM
Pfam:MMR_HSR1 64 180 1.5e-19 PFAM
Pfam:MMR_HSR1_Xtn 184 289 9.6e-50 PFAM
Pfam:TGS 290 363 2.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071880
SMART Domains Protein: ENSMUSP00000071777
Gene: ENSMUSG00000042678

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 87 100 N/A INTRINSIC
low complexity region 107 120 N/A INTRINSIC
low complexity region 269 292 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
low complexity region 311 325 N/A INTRINSIC
low complexity region 349 384 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 502 509 N/A INTRINSIC
low complexity region 653 681 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
low complexity region 737 747 N/A INTRINSIC
low complexity region 758 775 N/A INTRINSIC
low complexity region 781 792 N/A INTRINSIC
low complexity region 796 809 N/A INTRINSIC
low complexity region 825 849 N/A INTRINSIC
low complexity region 883 897 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
MYSc 1200 1884 N/A SMART
IQ 1885 1907 1.63e-1 SMART
IQ 1908 1930 1.77e-2 SMART
IQ 1931 1953 2.97e2 SMART
low complexity region 1955 1974 N/A INTRINSIC
low complexity region 1992 2006 N/A INTRINSIC
MyTH4 2049 2195 1.8e-42 SMART
low complexity region 2396 2405 N/A INTRINSIC
low complexity region 2451 2461 N/A INTRINSIC
Blast:MYSc 2665 2848 2e-14 BLAST
SH3 2851 2933 1.55e-4 SMART
low complexity region 2949 2962 N/A INTRINSIC
MyTH4 3031 3185 5.59e-48 SMART
B41 3188 3400 6.94e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000081823
SMART Domains Protein: ENSMUSP00000080507
Gene: ENSMUSG00000042678

DomainStartEndE-ValueType
MYSc 13 697 N/A SMART
IQ 698 720 1.63e-1 SMART
IQ 721 743 1.77e-2 SMART
IQ 744 766 2.97e2 SMART
low complexity region 787 801 N/A INTRINSIC
MyTH4 844 990 1.8e-42 SMART
low complexity region 1191 1200 N/A INTRINSIC
low complexity region 1246 1256 N/A INTRINSIC
Blast:MYSc 1460 1643 7e-15 BLAST
SH3 1646 1728 1.55e-4 SMART
low complexity region 1744 1757 N/A INTRINSIC
MyTH4 1826 1980 5.59e-48 SMART
B41 1983 2195 6.94e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000094135
SMART Domains Protein: ENSMUSP00000091686
Gene: ENSMUSG00000042678

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 87 100 N/A INTRINSIC
low complexity region 107 120 N/A INTRINSIC
low complexity region 269 292 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
low complexity region 311 325 N/A INTRINSIC
low complexity region 349 384 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 502 509 N/A INTRINSIC
low complexity region 653 681 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
low complexity region 737 747 N/A INTRINSIC
low complexity region 758 775 N/A INTRINSIC
low complexity region 781 792 N/A INTRINSIC
low complexity region 796 809 N/A INTRINSIC
low complexity region 825 849 N/A INTRINSIC
low complexity region 883 897 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
MYSc 1200 1884 N/A SMART
IQ 1885 1907 1.63e-1 SMART
IQ 1908 1930 1.77e-2 SMART
IQ 1931 1953 2.97e2 SMART
low complexity region 1974 1988 N/A INTRINSIC
MyTH4 2031 2177 1.8e-42 SMART
low complexity region 2378 2387 N/A INTRINSIC
low complexity region 2433 2443 N/A INTRINSIC
Blast:MYSc 2647 2830 2e-14 BLAST
SH3 2833 2915 1.55e-4 SMART
low complexity region 2931 2944 N/A INTRINSIC
MyTH4 3013 3167 5.59e-48 SMART
B41 3170 3382 6.94e-3 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTP-binding protein known to function in the regulation of cell growth and differentiation. Read-through transcripts containing this gene and a downstream gene have been identified, but they are not thought to encode a fusion protein. This gene is located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jan 2012]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700042G07Rik A G 4: 116,173,594 D65G probably benign Het
Adcy4 C A 14: 55,781,946 E82D probably damaging Het
AF067061 T A 13: 120,263,939 C46* probably null Het
Ago1 G A 4: 126,439,939 R486* probably null Het
Ago2 T A 15: 73,124,242 N346I possibly damaging Het
Apol11a A T 15: 77,517,195 D294V probably benign Het
Atp13a5 A G 16: 29,297,397 F634L possibly damaging Het
Atp2a2 G A 5: 122,457,513 P953L probably damaging Het
Brca2 A G 5: 150,539,672 D967G probably benign Het
Bud13 A T 9: 46,288,148 H269L probably benign Het
Cachd1 A T 4: 100,980,882 probably null Het
Cog3 T C 14: 75,741,742 D188G probably benign Het
Col15a1 T C 4: 47,208,492 S20P probably damaging Het
Col4a3 A G 1: 82,680,710 D838G unknown Het
Cwh43 A T 5: 73,421,543 T298S probably benign Het
Dip2c A G 13: 9,609,005 R847G probably damaging Het
Dnah2 C T 11: 69,516,644 D438N probably damaging Het
Eif4enif1 T A 11: 3,221,168 W220R probably damaging Het
Enpp2 A T 15: 54,919,694 I75K probably damaging Het
Fam110c T C 12: 31,075,239 I400T probably damaging Het
Fam193b C A 13: 55,542,816 R711L probably damaging Het
Fgfr1 T C 8: 25,563,446 Y246H probably damaging Het
Frs3 G A 17: 47,703,072 R230Q probably benign Het
Galnt5 A G 2: 57,999,413 K342E probably benign Het
Glrb A T 3: 80,861,747 L189Q probably damaging Het
Gmeb2 T C 2: 181,259,026 T193A probably benign Het
Gnl3 A G 14: 31,014,163 S307P probably damaging Het
Golim4 A T 3: 75,892,859 F443I probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Klf10 A C 15: 38,297,113 Y228D probably benign Het
Klrc3 A T 6: 129,639,557 W166R probably damaging Het
Kng2 A T 16: 22,988,315 I378N probably benign Het
Map3k10 T C 7: 27,663,263 K466R possibly damaging Het
Mrrf C T 2: 36,189,097 T245M probably benign Het
Msi1 A G 5: 115,445,458 Y239C probably damaging Het
Nfasc A G 1: 132,597,763 probably null Het
Olfr1375 T A 11: 51,048,473 L122Q probably damaging Het
Olfr843 A T 9: 19,249,061 C113S probably benign Het
Pkd1l1 T C 11: 8,958,900 E368G unknown Het
Polq G A 16: 37,089,325 G2078D probably damaging Het
Ppfibp1 A C 6: 146,992,444 I134L probably damaging Het
Rasip1 A T 7: 45,634,823 I608F probably damaging Het
Ripk3 A T 14: 55,788,035 V24E probably damaging Het
Rtkn T A 6: 83,147,545 I110N probably damaging Het
Scn1a C T 2: 66,273,832 V1695I probably damaging Het
Shank2 A G 7: 144,052,305 N75S possibly damaging Het
Snu13 C A 15: 82,043,981 A14S probably benign Het
Snx27 A C 3: 94,531,234 D231E probably damaging Het
Spef2 A G 15: 9,725,197 I158T possibly damaging Het
Sptb A G 12: 76,649,869 I19T possibly damaging Het
Ssu72 T C 4: 155,733,513 L175P probably damaging Het
Tecr C T 8: 83,572,575 V248I probably benign Het
Tnfrsf13b T G 11: 61,141,476 S59A probably benign Het
Tom1l1 T C 11: 90,671,125 T150A possibly damaging Het
Ubr3 A T 2: 69,936,018 Y410F probably damaging Het
Vmn2r108 A G 17: 20,472,315 I93T probably damaging Het
Vmn2r19 A G 6: 123,329,978 T482A probably benign Het
Vstm4 T A 14: 32,863,707 M77K probably benign Het
Zbtb17 C T 4: 141,464,585 T309I probably damaging Het
Zfp957 T C 14: 79,214,054 T102A probably damaging Het
Other mutations in Drg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03019:Drg2 APN 11 60456595 missense probably damaging 1.00
R0356:Drg2 UTSW 11 60461581 missense probably damaging 0.97
R1483:Drg2 UTSW 11 60459527 missense probably damaging 1.00
R1501:Drg2 UTSW 11 60464853 missense probably benign 0.00
R3434:Drg2 UTSW 11 60461392 nonsense probably null
R3824:Drg2 UTSW 11 60459508 missense possibly damaging 0.85
R3825:Drg2 UTSW 11 60459508 missense possibly damaging 0.85
R3898:Drg2 UTSW 11 60456634 missense probably benign
R4418:Drg2 UTSW 11 60468146 missense probably damaging 1.00
R4732:Drg2 UTSW 11 60461396 critical splice donor site probably null
R4733:Drg2 UTSW 11 60461396 critical splice donor site probably null
R4953:Drg2 UTSW 11 60459436 splice site probably benign
R5492:Drg2 UTSW 11 60461596 missense probably damaging 0.99
R6007:Drg2 UTSW 11 60462625 missense possibly damaging 0.55
R7282:Drg2 UTSW 11 60454693 missense probably benign 0.30
R7417:Drg2 UTSW 11 60454680 start codon destroyed probably null 0.77
R7697:Drg2 UTSW 11 60462177 missense probably damaging 0.98
R7822:Drg2 UTSW 11 60462200 nonsense probably null
R7911:Drg2 UTSW 11 60464175 missense possibly damaging 0.83
R7992:Drg2 UTSW 11 60464175 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- AGAGTTTGCACTGTAGGAGCTC -3'
(R):5'- AGGCTTTATAGGGAATGTCCTC -3'

Sequencing Primer
(F):5'- AGGAGCTCCTACTTCCTTGG -3'
(R):5'- TTATAGGGAATGTCCTCAGCAAAGCC -3'
Posted On2014-12-04