Incidental Mutation 'R2517:Tom1l1'
ID253962
Institutional Source Beutler Lab
Gene Symbol Tom1l1
Ensembl Gene ENSMUSG00000020541
Gene Nametarget of myb1-like 1 (chicken)
Synonyms2310045L10Rik, Srcasm
MMRRC Submission 040421-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.363) question?
Stock #R2517 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location90643465-90688366 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90671125 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 150 (T150A)
Ref Sequence ENSEMBL: ENSMUSP00000103501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020849] [ENSMUST00000107868] [ENSMUST00000107869] [ENSMUST00000154599]
Predicted Effect probably benign
Transcript: ENSMUST00000020849
AA Change: T226A

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000020849
Gene: ENSMUSG00000020541
AA Change: T226A

DomainStartEndE-ValueType
VHS 15 150 7.37e-53 SMART
Pfam:GAT 212 288 5.8e-17 PFAM
low complexity region 340 349 N/A INTRINSIC
low complexity region 409 416 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107868
AA Change: T149A

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103500
Gene: ENSMUSG00000020541
AA Change: T149A

DomainStartEndE-ValueType
Pfam:VHS 1 73 4.2e-10 PFAM
Pfam:GAT 119 220 5.5e-29 PFAM
low complexity region 263 272 N/A INTRINSIC
low complexity region 332 339 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107869
AA Change: T150A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103501
Gene: ENSMUSG00000020541
AA Change: T150A

DomainStartEndE-ValueType
VHS 15 152 7.23e-38 SMART
low complexity region 264 273 N/A INTRINSIC
low complexity region 333 340 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000154599
AA Change: T191A

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000123329
Gene: ENSMUSG00000020541
AA Change: T191A

DomainStartEndE-ValueType
VHS 15 150 7.37e-53 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700042G07Rik A G 4: 116,173,594 D65G probably benign Het
Adcy4 C A 14: 55,781,946 E82D probably damaging Het
AF067061 T A 13: 120,263,939 C46* probably null Het
Ago1 G A 4: 126,439,939 R486* probably null Het
Ago2 T A 15: 73,124,242 N346I possibly damaging Het
Apol11a A T 15: 77,517,195 D294V probably benign Het
Atp13a5 A G 16: 29,297,397 F634L possibly damaging Het
Atp2a2 G A 5: 122,457,513 P953L probably damaging Het
Brca2 A G 5: 150,539,672 D967G probably benign Het
Bud13 A T 9: 46,288,148 H269L probably benign Het
Cachd1 A T 4: 100,980,882 probably null Het
Cog3 T C 14: 75,741,742 D188G probably benign Het
Col15a1 T C 4: 47,208,492 S20P probably damaging Het
Col4a3 A G 1: 82,680,710 D838G unknown Het
Cwh43 A T 5: 73,421,543 T298S probably benign Het
Dip2c A G 13: 9,609,005 R847G probably damaging Het
Dnah2 C T 11: 69,516,644 D438N probably damaging Het
Drg2 T C 11: 60,468,128 V358A probably damaging Het
Eif4enif1 T A 11: 3,221,168 W220R probably damaging Het
Enpp2 A T 15: 54,919,694 I75K probably damaging Het
Fam110c T C 12: 31,075,239 I400T probably damaging Het
Fam193b C A 13: 55,542,816 R711L probably damaging Het
Fgfr1 T C 8: 25,563,446 Y246H probably damaging Het
Frs3 G A 17: 47,703,072 R230Q probably benign Het
Galnt5 A G 2: 57,999,413 K342E probably benign Het
Glrb A T 3: 80,861,747 L189Q probably damaging Het
Gmeb2 T C 2: 181,259,026 T193A probably benign Het
Gnl3 A G 14: 31,014,163 S307P probably damaging Het
Golim4 A T 3: 75,892,859 F443I probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Klf10 A C 15: 38,297,113 Y228D probably benign Het
Klrc3 A T 6: 129,639,557 W166R probably damaging Het
Kng2 A T 16: 22,988,315 I378N probably benign Het
Map3k10 T C 7: 27,663,263 K466R possibly damaging Het
Mrrf C T 2: 36,189,097 T245M probably benign Het
Msi1 A G 5: 115,445,458 Y239C probably damaging Het
Nfasc A G 1: 132,597,763 probably null Het
Olfr1375 T A 11: 51,048,473 L122Q probably damaging Het
Olfr843 A T 9: 19,249,061 C113S probably benign Het
Pkd1l1 T C 11: 8,958,900 E368G unknown Het
Polq G A 16: 37,089,325 G2078D probably damaging Het
Ppfibp1 A C 6: 146,992,444 I134L probably damaging Het
Rasip1 A T 7: 45,634,823 I608F probably damaging Het
Ripk3 A T 14: 55,788,035 V24E probably damaging Het
Rtkn T A 6: 83,147,545 I110N probably damaging Het
Scn1a C T 2: 66,273,832 V1695I probably damaging Het
Shank2 A G 7: 144,052,305 N75S possibly damaging Het
Snu13 C A 15: 82,043,981 A14S probably benign Het
Snx27 A C 3: 94,531,234 D231E probably damaging Het
Spef2 A G 15: 9,725,197 I158T possibly damaging Het
Sptb A G 12: 76,649,869 I19T possibly damaging Het
Ssu72 T C 4: 155,733,513 L175P probably damaging Het
Tecr C T 8: 83,572,575 V248I probably benign Het
Tnfrsf13b T G 11: 61,141,476 S59A probably benign Het
Ubr3 A T 2: 69,936,018 Y410F probably damaging Het
Vmn2r108 A G 17: 20,472,315 I93T probably damaging Het
Vmn2r19 A G 6: 123,329,978 T482A probably benign Het
Vstm4 T A 14: 32,863,707 M77K probably benign Het
Zbtb17 C T 4: 141,464,585 T309I probably damaging Het
Zfp957 T C 14: 79,214,054 T102A probably damaging Het
Other mutations in Tom1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Tom1l1 APN 11 90674740 missense probably damaging 1.00
IGL01995:Tom1l1 APN 11 90649861 missense probably damaging 0.96
R0057:Tom1l1 UTSW 11 90685149 splice site probably benign
R1557:Tom1l1 UTSW 11 90656384 missense possibly damaging 0.92
R1614:Tom1l1 UTSW 11 90683254 missense probably damaging 1.00
R1616:Tom1l1 UTSW 11 90656351 missense possibly damaging 0.92
R2165:Tom1l1 UTSW 11 90649895 splice site probably benign
R3745:Tom1l1 UTSW 11 90657741 missense probably benign 0.01
R4614:Tom1l1 UTSW 11 90671126 missense probably damaging 1.00
R4694:Tom1l1 UTSW 11 90646849 missense possibly damaging 0.86
R4755:Tom1l1 UTSW 11 90685116 missense probably damaging 1.00
R5397:Tom1l1 UTSW 11 90661774 missense probably benign 0.02
R6294:Tom1l1 UTSW 11 90661761 nonsense probably null
R6733:Tom1l1 UTSW 11 90685060 critical splice donor site probably null
R6911:Tom1l1 UTSW 11 90644161 intron probably null
R7103:Tom1l1 UTSW 11 90671081 splice site probably null
R7489:Tom1l1 UTSW 11 90656359 missense probably benign 0.00
R7696:Tom1l1 UTSW 11 90672915 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TACTTAGGCGCTGGAGAAATATG -3'
(R):5'- TTGATATTCCAGCAGGTGTCC -3'

Sequencing Primer
(F):5'- cacacatatatattgtacatgcta -3'
(R):5'- TCCTGTAGGAAGAAAGGAAGATAGCC -3'
Posted On2014-12-04