Mutagenetix > Incidental Mutations

Incidental Mutation 'R2517:Dip2c'

253968

Institutional Source

Beutler Lab

Gene Symbol

Dip2c

Ensembl Gene

ENSMUSG00000048264

Gene Name

disco interacting protein 2 homolog C

Synonyms

2900024P20Rik

MMRRC Submission

040421-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.783) question?

Stock #

R2517 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

9276528-9668928 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 9609005 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 847 (R847G)

Ref Sequence

ENSEMBL: ENSMUSP00000133806 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166299] [ENSMUST00000169960] [ENSMUST00000174552]

Predicted Effect

probably damaging
Transcript: ENSMUST00000166299
AA Change: R848G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126827
Gene: ENSMUSG00000048264
AA Change: R848G

Domain	Start	End	E-Value	Type
DMAP_binding	7	120	3.55e-43	SMART
low complexity region	170	187	N/A	INTRINSIC
low complexity region	275	287	N/A	INTRINSIC
Pfam:AMP-binding	324	801	3.6e-23	PFAM
Pfam:AMP-binding	977	1451	1.5e-72	PFAM
low complexity region	1514	1526	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000169960
AA Change: R818G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000131238
Gene: ENSMUSG00000048264
AA Change: R818G

Domain	Start	End	E-Value	Type
DMAP_binding	7	176	3.02e-37	SMART
low complexity region	226	243	N/A	INTRINSIC
low complexity region	331	343	N/A	INTRINSIC
Pfam:AMP-binding	380	637	5.9e-10	PFAM
SCOP:d1lci__	675	875	2e-8	SMART
Pfam:AMP-binding	947	1421	1.2e-56	PFAM
low complexity region	1484	1496	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000174552
AA Change: R847G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000133806
Gene: ENSMUSG00000048264
AA Change: R847G

Domain	Start	End	E-Value	Type
DMAP_binding	7	120	3.55e-43	SMART
low complexity region	170	187	N/A	INTRINSIC
low complexity region	275	287	N/A	INTRINSIC
Pfam:AMP-binding	324	800	2.7e-20	PFAM
Pfam:AMP-binding	976	1450	1.3e-56	PFAM
low complexity region	1513	1525	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000222280

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 family. The protein shares strong similarity with a Drosophila protein which interacts with the transcription factor disco and is expressed in the nervous system. [provided by RefSeq, Oct 2008]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700042G07Rik	A	G	4: 116,173,594	D65G	probably benign	Het
Adcy4	C	A	14: 55,781,946	E82D	probably damaging	Het
AF067061	T	A	13: 120,263,939	C46*	probably null	Het
Ago1	G	A	4: 126,439,939	R486*	probably null	Het
Ago2	T	A	15: 73,124,242	N346I	possibly damaging	Het
Apol11a	A	T	15: 77,517,195	D294V	probably benign	Het
Atp13a5	A	G	16: 29,297,397	F634L	possibly damaging	Het
Atp2a2	G	A	5: 122,457,513	P953L	probably damaging	Het
Brca2	A	G	5: 150,539,672	D967G	probably benign	Het
Bud13	A	T	9: 46,288,148	H269L	probably benign	Het
Cachd1	A	T	4: 100,980,882		probably null	Het
Cog3	T	C	14: 75,741,742	D188G	probably benign	Het
Col15a1	T	C	4: 47,208,492	S20P	probably damaging	Het
Col4a3	A	G	1: 82,680,710	D838G	unknown	Het
Cwh43	A	T	5: 73,421,543	T298S	probably benign	Het
Dnah2	C	T	11: 69,516,644	D438N	probably damaging	Het
Drg2	T	C	11: 60,468,128	V358A	probably damaging	Het
Eif4enif1	T	A	11: 3,221,168	W220R	probably damaging	Het
Enpp2	A	T	15: 54,919,694	I75K	probably damaging	Het
Fam110c	T	C	12: 31,075,239	I400T	probably damaging	Het
Fam193b	C	A	13: 55,542,816	R711L	probably damaging	Het
Fgfr1	T	C	8: 25,563,446	Y246H	probably damaging	Het
Frs3	G	A	17: 47,703,072	R230Q	probably benign	Het
Galnt5	A	G	2: 57,999,413	K342E	probably benign	Het
Glrb	A	T	3: 80,861,747	L189Q	probably damaging	Het
Gmeb2	T	C	2: 181,259,026	T193A	probably benign	Het
Gnl3	A	G	14: 31,014,163	S307P	probably damaging	Het
Golim4	A	T	3: 75,892,859	F443I	probably benign	Het
Hivep2	C	A	10: 14,128,969	T437K	probably benign	Het
Klf10	A	C	15: 38,297,113	Y228D	probably benign	Het
Klrc3	A	T	6: 129,639,557	W166R	probably damaging	Het
Kng2	A	T	16: 22,988,315	I378N	probably benign	Het
Map3k10	T	C	7: 27,663,263	K466R	possibly damaging	Het
Mrrf	C	T	2: 36,189,097	T245M	probably benign	Het
Msi1	A	G	5: 115,445,458	Y239C	probably damaging	Het
Nfasc	A	G	1: 132,597,763		probably null	Het
Olfr1375	T	A	11: 51,048,473	L122Q	probably damaging	Het
Olfr843	A	T	9: 19,249,061	C113S	probably benign	Het
Pkd1l1	T	C	11: 8,958,900	E368G	unknown	Het
Polq	G	A	16: 37,089,325	G2078D	probably damaging	Het
Ppfibp1	A	C	6: 146,992,444	I134L	probably damaging	Het
Rasip1	A	T	7: 45,634,823	I608F	probably damaging	Het
Ripk3	A	T	14: 55,788,035	V24E	probably damaging	Het
Rtkn	T	A	6: 83,147,545	I110N	probably damaging	Het
Scn1a	C	T	2: 66,273,832	V1695I	probably damaging	Het
Shank2	A	G	7: 144,052,305	N75S	possibly damaging	Het
Snu13	C	A	15: 82,043,981	A14S	probably benign	Het
Snx27	A	C	3: 94,531,234	D231E	probably damaging	Het
Spef2	A	G	15: 9,725,197	I158T	possibly damaging	Het
Sptb	A	G	12: 76,649,869	I19T	possibly damaging	Het
Ssu72	T	C	4: 155,733,513	L175P	probably damaging	Het
Tecr	C	T	8: 83,572,575	V248I	probably benign	Het
Tnfrsf13b	T	G	11: 61,141,476	S59A	probably benign	Het
Tom1l1	T	C	11: 90,671,125	T150A	possibly damaging	Het
Ubr3	A	T	2: 69,936,018	Y410F	probably damaging	Het
Vmn2r108	A	G	17: 20,472,315	I93T	probably damaging	Het
Vmn2r19	A	G	6: 123,329,978	T482A	probably benign	Het
Vstm4	T	A	14: 32,863,707	M77K	probably benign	Het
Zbtb17	C	T	4: 141,464,585	T309I	probably damaging	Het
Zfp957	T	C	14: 79,214,054	T102A	probably damaging	Het

Other mutations in Dip2c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Dip2c	APN	13	9493108	missense	probably damaging	0.97
IGL00426:Dip2c	APN	13	9606515	missense	probably damaging	1.00
IGL00503:Dip2c	APN	13	9567898	missense	probably damaging	1.00
IGL00586:Dip2c	APN	13	9610755	missense	probably damaging	1.00
IGL01306:Dip2c	APN	13	9575143	missense	possibly damaging	0.72
IGL01580:Dip2c	APN	13	9637088	splice site	probably null
IGL01985:Dip2c	APN	13	9553267	splice site	probably benign
IGL02060:Dip2c	APN	13	9622630	missense	probably damaging	0.98
IGL02122:Dip2c	APN	13	9506659	missense	possibly damaging	0.48
IGL02170:Dip2c	APN	13	9606335	missense	probably benign	0.03
IGL02211:Dip2c	APN	13	9610847	missense	probably damaging	1.00
IGL02755:Dip2c	APN	13	9550320	critical splice donor site	probably null
IGL02836:Dip2c	APN	13	9610790	missense	probably damaging	0.98
IGL02935:Dip2c	APN	13	9662146	missense	probably damaging	1.00
IGL03032:Dip2c	APN	13	9551778	missense	probably damaging	1.00
ANU23:Dip2c	UTSW	13	9575143	missense	possibly damaging	0.72
P0038:Dip2c	UTSW	13	9646982	missense	probably damaging	1.00
R0009:Dip2c	UTSW	13	9621903	missense	probably damaging	1.00
R0268:Dip2c	UTSW	13	9637150	missense	probably damaging	1.00
R0271:Dip2c	UTSW	13	9615775	missense	probably damaging	1.00
R0306:Dip2c	UTSW	13	9604599	missense	probably benign	0.09
R0415:Dip2c	UTSW	13	9568289	splice site	probably benign
R0519:Dip2c	UTSW	13	9563208	missense	probably damaging	1.00
R0557:Dip2c	UTSW	13	9553459	missense	possibly damaging	0.81
R0964:Dip2c	UTSW	13	9568663	missense	probably benign	0.43
R0973:Dip2c	UTSW	13	9576908	missense	probably damaging	0.99
R0973:Dip2c	UTSW	13	9576908	missense	probably damaging	0.99
R0974:Dip2c	UTSW	13	9576908	missense	probably damaging	0.99
R1101:Dip2c	UTSW	13	9634744	missense	probably damaging	1.00
R1171:Dip2c	UTSW	13	9493126	missense	possibly damaging	0.89
R1403:Dip2c	UTSW	13	9553264	splice site	probably null
R1403:Dip2c	UTSW	13	9553264	splice site	probably null
R1432:Dip2c	UTSW	13	9553304	missense	probably damaging	0.99
R1481:Dip2c	UTSW	13	9551866	critical splice donor site	probably null
R1588:Dip2c	UTSW	13	9665864	missense	probably damaging	1.00
R1721:Dip2c	UTSW	13	9659368	missense	probably damaging	1.00
R1726:Dip2c	UTSW	13	9575428	missense	probably damaging	1.00
R1867:Dip2c	UTSW	13	9621949	missense	possibly damaging	0.55
R1909:Dip2c	UTSW	13	9533350	missense	probably benign	0.00
R2013:Dip2c	UTSW	13	9567846	nonsense	probably null
R2022:Dip2c	UTSW	13	9551800	missense	probably damaging	1.00
R3746:Dip2c	UTSW	13	9601473	missense	probably damaging	1.00
R3794:Dip2c	UTSW	13	9604561	missense	probably damaging	0.99
R3884:Dip2c	UTSW	13	9551858	missense	probably damaging	1.00
R4019:Dip2c	UTSW	13	9614365	missense	probably damaging	0.99
R4110:Dip2c	UTSW	13	9637101	missense	probably damaging	1.00
R4111:Dip2c	UTSW	13	9637101	missense	probably damaging	1.00
R4113:Dip2c	UTSW	13	9637101	missense	probably damaging	1.00
R4256:Dip2c	UTSW	13	9609056	missense	probably damaging	1.00
R4300:Dip2c	UTSW	13	9610711	missense	probably damaging	1.00
R4494:Dip2c	UTSW	13	9571062	missense	possibly damaging	0.64
R4739:Dip2c	UTSW	13	9533339	missense	probably damaging	0.98
R4812:Dip2c	UTSW	13	9637130	nonsense	probably null
R4814:Dip2c	UTSW	13	9536860	missense	probably benign	0.07
R4816:Dip2c	UTSW	13	9575150	missense	probably benign	0.37
R4828:Dip2c	UTSW	13	9560679	missense	probably damaging	1.00
R4915:Dip2c	UTSW	13	9621869	splice site	probably null
R4917:Dip2c	UTSW	13	9621869	splice site	probably null
R4932:Dip2c	UTSW	13	9623972	missense	probably damaging	0.99
R4993:Dip2c	UTSW	13	9575223	nonsense	probably null
R5043:Dip2c	UTSW	13	9551827	missense	possibly damaging	0.80
R5349:Dip2c	UTSW	13	9622653	missense	probably damaging	1.00
R5744:Dip2c	UTSW	13	9568405	missense	probably damaging	1.00
R5840:Dip2c	UTSW	13	9506676	missense	possibly damaging	0.68
R6110:Dip2c	UTSW	13	9623766	missense	probably damaging	1.00
R6160:Dip2c	UTSW	13	9533254	missense	probably benign	0.01
R6161:Dip2c	UTSW	13	9647007	missense	probably damaging	1.00
R6477:Dip2c	UTSW	13	9623760	missense	probably damaging	1.00
R6522:Dip2c	UTSW	13	9575228	critical splice donor site	probably null
R6603:Dip2c	UTSW	13	9654588	splice site	probably null
R6658:Dip2c	UTSW	13	9493177	critical splice donor site	probably null
R6672:Dip2c	UTSW	13	9567830	critical splice acceptor site	probably null
R6697:Dip2c	UTSW	13	9621913	missense	probably damaging	1.00
R6991:Dip2c	UTSW	13	9551860	nonsense	probably null
R6991:Dip2c	UTSW	13	9634832	missense	probably damaging	1.00
R7018:Dip2c	UTSW	13	9659278	missense	probably damaging	1.00
R7053:Dip2c	UTSW	13	9610704	missense	probably damaging	1.00
R7102:Dip2c	UTSW	13	9604536	missense	probably benign	0.01
R7171:Dip2c	UTSW	13	9506648	missense	probably benign	0.34
R7371:Dip2c	UTSW	13	9592749	missense	probably benign	0.02
R7395:Dip2c	UTSW	13	9614377	missense	probably damaging	1.00
R7489:Dip2c	UTSW	13	9533312	missense	probably damaging	0.99
R7575:Dip2c	UTSW	13	9628012	missense	probably damaging	0.97
R7642:Dip2c	UTSW	13	9622705	critical splice donor site	probably null
R7687:Dip2c	UTSW	13	9604581	missense	probably benign	0.00
R7699:Dip2c	UTSW	13	9659311	missense	probably benign	0.00
R7700:Dip2c	UTSW	13	9659311	missense	probably benign	0.00
R7715:Dip2c	UTSW	13	9614391	missense	probably damaging	1.00
R7842:Dip2c	UTSW	13	9606533	critical splice donor site	probably null
R7845:Dip2c	UTSW	13	9609044	missense	probably damaging	1.00
R8354:Dip2c	UTSW	13	9621882	missense	probably benign	0.05
R8685:Dip2c	UTSW	13	9637125	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CCCTCAGCCTTAGTCTACAAG -3'
(R):5'- TCAGCTTGTTTCTGGACACTATAG -3'

Sequencing Primer
(F):5'- CTCAGCCTTAGTCTACAAGTAGTGTG -3'
(R):5'- GGACACTATAGAATTTCCAATCAGAC -3'

Posted On

2014-12-04