Incidental Mutation 'R2760:Olfr1415'
ID253971
Institutional Source Beutler Lab
Gene Symbol Olfr1415
Ensembl Gene ENSMUSG00000057464
Gene Nameolfactory receptor 1415
SynonymsGA_x6K02T2R7CC-81266841-81267776, MOR103-12
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R2760 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location92489101-92496101 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92491080 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 225 (V225A)
Ref Sequence ENSEMBL: ENSMUSP00000145446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071521] [ENSMUST00000204009] [ENSMUST00000204766]
Predicted Effect probably damaging
Transcript: ENSMUST00000071521
AA Change: V225A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000084047
Gene: ENSMUSG00000057464
AA Change: V225A

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.3e-53 PFAM
Pfam:7tm_1 41 290 1.2e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204009
AA Change: V225A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000145446
Gene: ENSMUSG00000057464
AA Change: V225A

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.3e-53 PFAM
Pfam:7tm_1 41 290 1.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204766
SMART Domains Protein: ENSMUSP00000144986
Gene: ENSMUSG00000057464

DomainStartEndE-ValueType
Blast:CLECT 1 65 1e-7 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg11 C A 8: 22,068,079 A469E probably benign Het
Atp8a2 C T 14: 59,860,192 V796I probably benign Het
Btnl1 T G 17: 34,381,038 W172G probably damaging Het
Ceacam1 T C 7: 25,477,474 T21A probably damaging Het
Fam69b A G 2: 26,635,825 H257R probably benign Het
Frmpd1 A C 4: 45,244,667 I119L possibly damaging Het
Haus6 A T 4: 86,583,176 Y819* probably null Het
Ildr2 A G 1: 166,303,606 R344G probably damaging Het
Irs1 T C 1: 82,288,570 I642V probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lum T C 10: 97,568,771 V176A probably benign Het
Nobox A G 6: 43,304,106 L478P probably damaging Het
Olfr1200 T A 2: 88,767,636 R226S possibly damaging Het
Olfr544 T C 7: 102,484,376 H248R probably damaging Het
Olfr8 A T 10: 78,956,042 Y279F probably damaging Het
Olfr981 T A 9: 40,022,396 M1K probably null Het
Rtn1 A T 12: 72,408,362 C64S probably benign Het
Senp6 A G 9: 80,121,978 Y285C probably null Het
Slco1a5 C A 6: 142,250,271 M335I probably benign Het
Spg11 A T 2: 122,097,359 I648K probably damaging Het
Ube2cbp T C 9: 86,422,974 I272V probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Utrn A G 10: 12,690,878 V1180A probably damaging Het
Vill T C 9: 119,066,882 probably null Het
Vmn2r101 T C 17: 19,589,639 I229T probably benign Het
Zbtb8b A T 4: 129,432,500 L291M probably benign Het
Other mutations in Olfr1415
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03066:Olfr1415 APN 1 92491583 missense probably damaging 1.00
R0538:Olfr1415 UTSW 1 92491333 missense possibly damaging 0.77
R0924:Olfr1415 UTSW 1 92491405 missense possibly damaging 0.95
R0930:Olfr1415 UTSW 1 92491405 missense possibly damaging 0.95
R1025:Olfr1415 UTSW 1 92491723 missense probably benign 0.19
R1201:Olfr1415 UTSW 1 92491153 missense probably benign 0.04
R1413:Olfr1415 UTSW 1 92490888 missense probably damaging 1.00
R1510:Olfr1415 UTSW 1 92491617 missense probably damaging 1.00
R1846:Olfr1415 UTSW 1 92491100 nonsense probably null
R1850:Olfr1415 UTSW 1 92491402 missense possibly damaging 0.89
R1940:Olfr1415 UTSW 1 92491735 missense probably benign 0.14
R4066:Olfr1415 UTSW 1 92491189 missense probably damaging 1.00
R4837:Olfr1415 UTSW 1 92490975 missense probably benign 0.39
R5310:Olfr1415 UTSW 1 92491036 missense probably damaging 1.00
R5503:Olfr1415 UTSW 1 92491196 missense probably benign 0.07
R5748:Olfr1415 UTSW 1 92491093 missense probably damaging 0.99
R5760:Olfr1415 UTSW 1 92491200 missense possibly damaging 0.95
R5853:Olfr1415 UTSW 1 92491717 missense probably benign 0.00
R5926:Olfr1415 UTSW 1 92491566 missense probably damaging 1.00
R6199:Olfr1415 UTSW 1 92491542 missense possibly damaging 0.89
R7585:Olfr1415 UTSW 1 92491320 missense probably benign 0.10
R7627:Olfr1415 UTSW 1 92491385 nonsense probably null
R7726:Olfr1415 UTSW 1 92491307 missense probably benign 0.30
R8011:Olfr1415 UTSW 1 92491275 missense possibly damaging 0.60
R8306:Olfr1415 UTSW 1 92491525 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- GTGAGGACAGTGTACACAGC -3'
(R):5'- TTGCAAGTGCCTTCACAGTCTC -3'

Sequencing Primer
(F):5'- TACACAGCAGAGATGAGCTTGTTG -3'
(R):5'- ACAGTCTCTGTGATTAAGGTCTAC -3'
Posted On2014-12-04