Incidental Mutation 'R2760:Ildr2'
ID253973
Institutional Source Beutler Lab
Gene Symbol Ildr2
Ensembl Gene ENSMUSG00000040612
Gene Nameimmunoglobulin-like domain containing receptor 2
SynonymsD1Ertd471e, ENSMUSG00000040612, 2810478N18Rik, 3110063L10Rik, OTTMUSG00000021748, Dbsm1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.420) question?
Stock #R2760 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location166254139-166316823 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 166303606 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 344 (R344G)
Ref Sequence ENSEMBL: ENSMUSP00000107047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111416] [ENSMUST00000192426] [ENSMUST00000192638] [ENSMUST00000192732] [ENSMUST00000193860] [ENSMUST00000194964] [ENSMUST00000195557]
Predicted Effect probably damaging
Transcript: ENSMUST00000111416
AA Change: R344G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107047
Gene: ENSMUSG00000040612
AA Change: R344G

DomainStartEndE-ValueType
transmembrane domain 19 41 N/A INTRINSIC
IG 42 181 4.6e-3 SMART
Pfam:LSR 201 248 2e-26 PFAM
low complexity region 260 278 N/A INTRINSIC
low complexity region 512 527 N/A INTRINSIC
low complexity region 591 607 N/A INTRINSIC
low complexity region 639 650 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168347
SMART Domains Protein: ENSMUSP00000131549
Gene: ENSMUSG00000091393

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
low complexity region 33 45 N/A INTRINSIC
low complexity region 80 113 N/A INTRINSIC
low complexity region 139 150 N/A INTRINSIC
low complexity region 180 193 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192426
SMART Domains Protein: ENSMUSP00000141961
Gene: ENSMUSG00000040612

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
IG 42 181 1.9e-5 SMART
IG_like 121 167 2.9e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000192638
AA Change: R325G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142311
Gene: ENSMUSG00000040612
AA Change: R325G

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
IG 42 181 1.9e-5 SMART
IG_like 121 167 2.9e-2 SMART
Pfam:LSR 182 230 2e-23 PFAM
low complexity region 241 259 N/A INTRINSIC
low complexity region 493 508 N/A INTRINSIC
low complexity region 572 588 N/A INTRINSIC
low complexity region 620 631 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000192732
AA Change: R217G
SMART Domains Protein: ENSMUSP00000141502
Gene: ENSMUSG00000040612
AA Change: R217G

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
IG 42 181 1.9e-5 SMART
IG_like 121 167 2.9e-2 SMART
low complexity region 385 400 N/A INTRINSIC
low complexity region 464 480 N/A INTRINSIC
low complexity region 512 523 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000193860
AA Change: R236G
SMART Domains Protein: ENSMUSP00000141323
Gene: ENSMUSG00000040612
AA Change: R236G

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
IG 42 181 1.9e-5 SMART
IG_like 121 167 2.9e-2 SMART
low complexity region 404 419 N/A INTRINSIC
low complexity region 483 499 N/A INTRINSIC
low complexity region 531 542 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000194964
AA Change: R285G
SMART Domains Protein: ENSMUSP00000142152
Gene: ENSMUSG00000040612
AA Change: R285G

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
IG 42 181 1.9e-5 SMART
IG_like 121 167 2.9e-2 SMART
Pfam:LSR 201 249 1.9e-23 PFAM
low complexity region 453 468 N/A INTRINSIC
low complexity region 532 548 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000195557
AA Change: R344G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142240
Gene: ENSMUSG00000040612
AA Change: R344G

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
IG 42 181 1.9e-5 SMART
IG_like 121 167 2.9e-2 SMART
Pfam:LSR 201 249 1.2e-23 PFAM
low complexity region 260 278 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced stop mutation at threonine-87 display a reduced pancreatic beta-cell replication rate, decreased beta-cell mass, reduced insulin/glucose ratio in blood, impaired glucose tolerance, and persistent mild hypoinsulinemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg11 C A 8: 22,068,079 A469E probably benign Het
Atp8a2 C T 14: 59,860,192 V796I probably benign Het
Btnl1 T G 17: 34,381,038 W172G probably damaging Het
Ceacam1 T C 7: 25,477,474 T21A probably damaging Het
Fam69b A G 2: 26,635,825 H257R probably benign Het
Frmpd1 A C 4: 45,244,667 I119L possibly damaging Het
Haus6 A T 4: 86,583,176 Y819* probably null Het
Irs1 T C 1: 82,288,570 I642V probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lum T C 10: 97,568,771 V176A probably benign Het
Nobox A G 6: 43,304,106 L478P probably damaging Het
Olfr1200 T A 2: 88,767,636 R226S possibly damaging Het
Olfr1415 A G 1: 92,491,080 V225A probably damaging Het
Olfr544 T C 7: 102,484,376 H248R probably damaging Het
Olfr8 A T 10: 78,956,042 Y279F probably damaging Het
Olfr981 T A 9: 40,022,396 M1K probably null Het
Rtn1 A T 12: 72,408,362 C64S probably benign Het
Senp6 A G 9: 80,121,978 Y285C probably null Het
Slco1a5 C A 6: 142,250,271 M335I probably benign Het
Spg11 A T 2: 122,097,359 I648K probably damaging Het
Ube2cbp T C 9: 86,422,974 I272V probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Utrn A G 10: 12,690,878 V1180A probably damaging Het
Vill T C 9: 119,066,882 probably null Het
Vmn2r101 T C 17: 19,589,639 I229T probably benign Het
Zbtb8b A T 4: 129,432,500 L291M probably benign Het
Other mutations in Ildr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01993:Ildr2 APN 1 166269370 missense possibly damaging 0.76
R0079:Ildr2 UTSW 1 166307720 missense probably damaging 1.00
R0371:Ildr2 UTSW 1 166303564 missense probably damaging 1.00
R0426:Ildr2 UTSW 1 166308899 missense probably benign 0.00
R1528:Ildr2 UTSW 1 166270495 splice site probably null
R1570:Ildr2 UTSW 1 166303585 missense probably damaging 1.00
R2143:Ildr2 UTSW 1 166269326 missense probably damaging 1.00
R3960:Ildr2 UTSW 1 166309340 missense probably damaging 0.99
R4965:Ildr2 UTSW 1 166307840 missense probably damaging 1.00
R5101:Ildr2 UTSW 1 166307762 missense probably damaging 1.00
R5351:Ildr2 UTSW 1 166308909 missense possibly damaging 0.58
R6021:Ildr2 UTSW 1 166303604 missense possibly damaging 0.77
R6841:Ildr2 UTSW 1 166270575 missense probably damaging 1.00
R7028:Ildr2 UTSW 1 166303529 missense probably damaging 1.00
R7117:Ildr2 UTSW 1 166295811 missense probably damaging 1.00
R7169:Ildr2 UTSW 1 166307934 critical splice donor site probably null
R7344:Ildr2 UTSW 1 166294597 missense probably damaging 1.00
R7612:Ildr2 UTSW 1 166307792 missense probably benign 0.43
R7697:Ildr2 UTSW 1 166294731 missense probably benign 0.21
R7869:Ildr2 UTSW 1 166309292 missense probably benign 0.01
R7908:Ildr2 UTSW 1 166307800 missense probably damaging 1.00
X0009:Ildr2 UTSW 1 166269311 missense probably benign 0.05
Z1177:Ildr2 UTSW 1 166309049 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTGGGCAATTGTTCTAACTGG -3'
(R):5'- ACGCTTTCACTAGAATCCCC -3'

Sequencing Primer
(F):5'- GGAACCATGTTTTTCTGCTTGG -3'
(R):5'- GCTTTCACTAGAATCCCCTTCTATTC -3'
Posted On2014-12-04